Быстрый заказ

Человек KIF2C/MCAK Джин ORF экспрессии кДНК клона плазмиды

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек KIF2C Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:BC014924
    Размер кДНК:2178bp
    Описание кДНК:Full length Clone DNA of Homo sapiens kinesin family member 2C.
    Синоним гена:RP11-269F19.1, KNSL6, MCAK, KIF2C
    Виды:Human
    переносчик:pCMV3-untagged
    Plasmid:
    Участок рестрикции:
    Последовательность меток:
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with KIF2C qPCR primers for gene expression analysis, HP102869 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    Человек KIF2C/MCAK Джин ORF экспрессии кДНК клона плазмиды on other vectors
    Человек KIF2C/MCAK Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14219-ACGRBS16760
    Человек KIF2C/MCAK Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14219-ACRRBS16760
    Человек KIF2C/MCAK Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG14219-ANGRBS16760
    Человек KIF2C/MCAK Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG14219-ANRRBS16760
    Человек KIF2C/MCAK Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14219-CFRBS14710
    Человек KIF2C/MCAK Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14219-CHRBS14710
    Человек KIF2C/MCAK Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14219-CMRBS14710
    Человек KIF2C/MCAK Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14219-CYRBS14710
    Человек KIF2C/MCAK Джин клон кДНК в вектор клонированияHG14219-GRBS5130
    Человек KIF2C/MCAK Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14219-NFRBS14710
    Человек KIF2C/MCAK Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14219-NHRBS14710
    Человек KIF2C/MCAK Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14219-NMRBS14710
    Человек KIF2C/MCAK Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14219-NYRBS14710
    Человек KIF2C/MCAK Джин ORF экспрессии кДНК клона плазмидыHG14219-UTRBS14710
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: HG14219-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».