Быстрый заказ

Человек KIF20A Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек KIF20A Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:BC012999
    Размер кДНК:2673bp
    Описание кДНК:Full length Clone DNA of Homo sapiens kinesin family member 20A with C terminal Myc tag.
    Синоним гена:MKLP2, RAB6KIFL
    Виды:Human
    переносчик:pCMV3-C-Myc
    Plasmid:
    Участок рестрикции:
    Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with KIF20A qPCR primers for gene expression analysis, HP104231 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    Myc Tag Info

    A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

    The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

    Человек KIF20A Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка on other vectors
    Человек KIF20A Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG15612-ACGRBS22240
    Человек KIF20A Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG15612-ACRRBS22240
    Человек KIF20A Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG15612-CFRBS20190
    Человек KIF20A Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG15612-CHRBS20190
    Человек KIF20A Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG15612-CMRBS20190
    Человек KIF20A Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG15612-CYRBS20190
    Человек KIF20A Джин клон кДНК в вектор клонированияHG15612-GRBS5130
    Человек KIF20A Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG15612-NFRBS20190
    Человек KIF20A Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG15612-NHRBS20190
    Человек KIF20A Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG15612-NMRBS20190
    Человек KIF20A Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG15612-NYRBS20190
    Человек KIF20A Джин ORF экспрессии кДНК клона плазмидыHG15612-UTRBS20190
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».