Быстрый заказ

Человек Ketohexokinase/KHK Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human KHK Информация о продукте «Клон cDNA»
Размер кДНК:897bp
Описание кДНК:Full length Clone DNA of Homo sapiens ketohexokinase (fructokinase) with N terminal Flag tag.
Синоним гена:KHK
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Человек Ketohexokinase/KHK Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Человек Ketohexokinase/KHK Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG16336-ACGRBS15400
Человек Ketohexokinase/KHK Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG16336-ACRRBS15400
Человек Ketohexokinase/KHK Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG16336-ANGRBS15400
Человек Ketohexokinase/KHK Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG16336-ANRRBS15400
Человек Ketohexokinase/KHK Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG16336-CFRBS13340
Человек Ketohexokinase/KHK Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG16336-CHRBS13340
Человек Ketohexokinase/KHK Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG16336-CMRBS13340
Человек Ketohexokinase/KHK Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG16336-CYRBS13340
Человек Ketohexokinase/KHK Джин клон кДНК в вектор клонированияHG16336-GRBS5130
Человек Ketohexokinase/KHK Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG16336-NFRBS13340
Человек Ketohexokinase/KHK Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG16336-NHRBS13340
Человек Ketohexokinase/KHK Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG16336-NMRBS13340
Человек Ketohexokinase/KHK Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG16336-NYRBS13340
Человек Ketohexokinase/KHK Джин ORF экспрессии кДНК клона плазмидыHG16336-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG16336-NF
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.