Быстрый заказ

Человек KDM3B / JMJD1B Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human KDM3B Информация о продукте «Клон cDNA»
Размер кДНК:2280bp
Описание кДНК:Full length Clone DNA of Homo sapiens lysine (K)-specific demethylase 3B with N terminal Myc tag.
Синоним гена:5qNCA, NET22, C5orf7, JMJD1B, KDM3B
Участок рестрикции:HindIII(two restriction sites) + XbaI (6kb + 0.86kb + 1.48kb)
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Human KDM3B Gene Plasmid Map
Human KDM3B ORF mammalian expression plasmid, N-Myc tag
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Человек KDM3B / JMJD1B Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Человек KDM3B / JMJD1B Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14315-ACGRBS16760
Человек KDM3B / JMJD1B Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14315-ACRRBS16760
Человек KDM3B / JMJD1B Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG14315-ANGRBS16760
Человек KDM3B / JMJD1B Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG14315-ANRRBS16760
Человек KDM3B / JMJD1B Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14315-CFRBS14710
Человек KDM3B / JMJD1B Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14315-CHRBS14710
Человек KDM3B / JMJD1B Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14315-CMRBS14710
Человек KDM3B / JMJD1B Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14315-CYRBS14710
Человек KDM3B / JMJD1B Джин клон кДНК в вектор клонированияHG14315-GRBS5130
Человек KDM3B / JMJD1B Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14315-NFRBS14710
Человек KDM3B / JMJD1B Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14315-NHRBS14710
Человек KDM3B / JMJD1B Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14315-NMRBS14710
Человек KDM3B / JMJD1B Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14315-NYRBS14710
Человек KDM3B / JMJD1B Джин ORF экспрессии кДНК клона плазмидыHG14315-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.