Быстрый заказ

Человек KATNA1/Katanin p60 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human KATNA1 Информация о продукте «Клон cDNA»
Размер кДНК:936bp
Описание кДНК:Full length Clone DNA of Homo sapiens katanin p60 (ATPase containing) subunit A 1 with C terminal HA tag.
Синоним гена:KATNA1
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Человек KATNA1/Katanin p60 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Человек KATNA1/Katanin p60 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG15168-ACGRBS15396
Человек KATNA1/Katanin p60 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG15168-ACRRBS15396
Человек KATNA1/Katanin p60 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG15168-ANGRBS15396
Человек KATNA1/Katanin p60 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG15168-ANRRBS15396
Человек KATNA1/Katanin p60 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG15168-CFRBS13343
Человек KATNA1/Katanin p60 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG15168-CHRBS13343
Человек KATNA1/Katanin p60 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG15168-CMRBS13343
Человек KATNA1/Katanin p60 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG15168-CYRBS13343
Человек KATNA1/Katanin p60 Джин клон кДНК в вектор клонированияHG15168-GRBS5132
Человек KATNA1/Katanin p60 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG15168-NFRBS13343
Человек KATNA1/Katanin p60 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG15168-NHRBS13343
Человек KATNA1/Katanin p60 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG15168-NMRBS13343
Человек KATNA1/Katanin p60 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG15168-NYRBS13343
Человек KATNA1/Katanin p60 Джин ORF экспрессии кДНК клона плазмидыHG15168-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG15168-CY
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.