After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Человек γ-Catenin/JUP Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human JUP Информация о продукте «Клон cDNA»
Gene_bank_ref_id:XM_006721878.1
Размер кДНК:2238bp
Описание кДНК:Full length Clone DNA of Homo sapiens junction plakoglobin.
Синоним гена:DP3; PDGB; PKGB; CTNNG; DPIII; ARVD12
Виды:Human
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек γ-Catenin/JUP Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек γ-Catenin/JUP Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG12020-ACGRBS16760
Человек γ-Catenin/JUP Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG12020-ACRRBS16760
Человек γ-Catenin/JUP Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG12020-ANGRBS16760
Человек γ-Catenin/JUP Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG12020-ANRRBS16760
Человек γ-Catenin/JUP Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG12020-CFRBS14710
Человек γ-Catenin/JUP Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG12020-CHRBS14710
Человек γ-Catenin/JUP Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG12020-CMRBS14710
Человек γ-Catenin/JUP Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG12020-CYRBS14710
Человек γ-Catenin/JUP Джин клон кДНК в вектор клонированияHG12020-GRBS5130
Человек γ-Catenin/JUP Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG12020-NFRBS14710
Человек γ-Catenin/JUP Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG12020-NHRBS14710
Человек γ-Catenin/JUP Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG12020-NMRBS14710
Человек γ-Catenin/JUP Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG12020-NYRBS14710
Человек γ-Catenin/JUP Джин ORF экспрессии кДНК клона плазмидыHG12020-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG12020-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».