After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек jumping translocation breakpoint / JTB Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human JTB Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC000499
Размер кДНК:441bp
Описание кДНК:Full length Clone DNA of Homo sapiens jumping translocation breakpoint with C terminal HA tag.
Синоним гена:PAR, hJT, HJTB, HSPC222, JTB
Виды:Human
переносчик:pCMV3-C-HA
Plasmid:
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Человек jumping translocation breakpoint / JTB Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Человек jumping translocation breakpoint / JTB Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13447-ACGRBS15400
Человек jumping translocation breakpoint / JTB Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13447-ACRRBS15400
Человек jumping translocation breakpoint / JTB Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13447-CFRBS13340
Человек jumping translocation breakpoint / JTB Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13447-CHRBS13340
Человек jumping translocation breakpoint / JTB Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13447-CMRBS13340
Человек jumping translocation breakpoint / JTB Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13447-CYRBS13340
Человек jumping translocation breakpoint / JTB Джин клон кДНК в вектор клонированияHG13447-GRBS5130
Человек jumping translocation breakpoint / JTB Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13447-NFRBS13340
Человек jumping translocation breakpoint / JTB Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13447-NHRBS13340
Человек jumping translocation breakpoint / JTB Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13447-NMRBS13340
Человек jumping translocation breakpoint / JTB Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13447-NYRBS13340
Человек jumping translocation breakpoint / JTB Джин ORF экспрессии кДНК клона плазмидыHG13447-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Jumping translocation breakpoint, also known as JTB, is a member of the JTB family. Jumping translocation (JT) is an unbalanced translocation that comprises amplified chromosomalsegments jumping to various telomeres. JTB is expressed in all normal human tissues studied but overexpressed or underexpressed in many of their malignant counterparts. It is required for normal cytokinesis during mitosis. JTB plays a role in the regulation of cell proliferation. It may be a component of the chromosomal passenger complex (CPC), a complex that acts as a key regulator of mitosis. The CPC complex has essential functions at the centromere in ensuring correct chromosome alignment and segregation and is required for chromatin-induced microtubule stabilization and spindle assembly.

Ссылки
  • Hatakeyama S. et al., 1999, Oncogene. 18 (12): 2085-90.
  • Platica O. et al., 2000, Int J Oncol. 16 (5): 1055-61.
  • Erhard DS. et al., 2004, Genome Res. 14 (10B): 2121-7.
  • Size / Price
    Каталог: HG13447-CY
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».