Быстрый заказ

Человек Junctional Adhesion Molecule B Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек JAM2 Информация о продукте «Клон cDNA»
    Размер кДНК:897bp
    Описание кДНК:Full length Clone DNA of Homo sapiens junctional adhesion molecule 2 with C terminal Myc tag.
    Синоним гена:JAMB, CD322, JAM-B, VEJAM, PRO245, VE-JAM, C21orf43
    Участок рестрикции:
    Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
    Описание последовательности:
    ( We provide with JAM2 qPCR primers for gene expression analysis, HP100585 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    Myc Tag Info

    A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

    The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

    Человек Junctional Adhesion Molecule B Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка on other vectors
    Человек Junctional Adhesion Molecule B Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10580-ACGRBS15400
    Человек Junctional Adhesion Molecule B Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10580-ACRRBS15400
    Человек Junctional Adhesion Molecule B Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10580-CFRBS13340
    Человек Junctional Adhesion Molecule B Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10580-CHRBS13340
    Человек Junctional Adhesion Molecule B Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10580-CMRBS13340
    Человек Junctional Adhesion Molecule B Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10580-CYRBS13340
    Человек Junctional Adhesion Molecule B Джин клон кДНК в вектор клонированияHG10580-MRBS5130
    Человек Junctional Adhesion Molecule B Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10580-M-FRBS13340
    Человек Junctional Adhesion Molecule B Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10580-NFRBS13340
    Человек Junctional Adhesion Molecule B Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10580-NHRBS13340
    Человек Junctional Adhesion Molecule B Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10580-NMRBS13340
    Человек Junctional Adhesion Molecule B Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10580-NYRBS13340
    Человек Junctional Adhesion Molecule B Джин ORF экспрессии кДНК клона плазмидыHG10580-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name

    Junctional adhesion molecule B (JAM-B), also known as Junctional adhesion molecule 2 (JAM2), Vascular endothelial junction-associated molecule (VE-JAM), and CD322, is a single-pass type I membrane protein which belongs to the immunoglobulin superfamily. It is prominently expressed on high endothelial venules. expression to be restricted to the high endothelial venule of tonsil and lymph nodes. The localization to the endothelium of arterioles in and around inflammatory and tumor foci. JAM-B can function as an adhesive ligand for the T cell line J45 and can interact with GM-CSF/IL-4-derived peripheral blood dendritic cells, circulating CD56(+) NK cells, circulating CD56(+)CD3(+) NK/T cells, and circulating CD56(+)CD3(+)CD8(+) cytolytic T cells. JAM-2 is expressed on high endothelial venules (HEVs) in human tonsil and on a subset of human leukocytes, suggesting that JAM-2 plays a central role in the regulation of transendothelial migration. It binds to very late activation antigen (VLA)-4, a leucocyte integrin that contributes to rolling and firm adhesion of lymphocytes to endothelial cells through binding to vascular cell adhesion molecule (VCAM)-1. JAM-B appears to contribute to leucocyte extravasation by facilitating not only transmigration but also rolling and adhesion. JAM-B acts as an adhesive ligand for interacting with a variety of immune cell types and may play a role in lymphocyte homing to secondary lymphoid organs.

  • Johnson-Lger CA, et al. (2002) Junctional adhesion molecule-2 (JAM-2) promotes lymphocyte transendothelial migration. Blood. 2100(7): 2479-86.
  • Liang TW, et al. (2002) Vascular endothelial-junctional adhesion molecule (VE-JAM)/JAM 2 interacts with T, NK, and dendritic cells through JAM 3. J Immunol. 168(4): 1618-26.
  • Ludwig RJ, et al. (2009) Junctional adhesion molecule (JAM)-B supports lymphocyte rolling and adhesion through interaction with alpha4beta1 integrin. Immunology. 128(2): 196-205.
  • Size / Price
    Каталог: HG10580-CM
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.