After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Человек JAK2 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human JAK2 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_004972.3
Размер кДНК:3399bp
Описание кДНК:Full length Clone DNA of Homo sapiens Janus kinase 2.
Синоним гена:JTK10, JAK2
Виды:Human
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек JAK2 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек JAK2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG11198-ACGRBS22240
Человек JAK2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG11198-ACRRBS22240
Человек JAK2 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG11198-ANGRBS22240
Человек JAK2 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG11198-ANRRBS22240
Человек JAK2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11198-CFRBS20190
Человек JAK2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG11198-CHRBS20190
Человек JAK2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG11198-CMRBS20190
Человек JAK2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG11198-CYRBS20190
Человек JAK2 Джин клон кДНК в вектор клонированияHG11198-GRBS5130
Человек JAK2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG11198-NFRBS20190
Человек JAK2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG11198-NHRBS20190
Человек JAK2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG11198-NMRBS20190
Человек JAK2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG11198-NYRBS20190
Человек JAK2 Джин ORF экспрессии кДНК клона плазмидыHG11198-UTRBS20190
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG11198-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие4-5 weeks
Запрос по оптовому заказуДобавить в корзину
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».