Быстрый заказ

Человек CD18/Integrin beta 2/ITGB2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human ITGB2 Информация о продукте «Клон cDNA»
Размер кДНК:2310bp
Описание кДНК:Full length Clone DNA of Homo sapiens integrin, beta 2 (complement component 3 receptor 3 and 4 subunit) with C terminal Flag tag.
Синоним гена:LAD, CD18, MF17, MFI7, LCAMB, LFA-1, MAC-1
Участок рестрикции:KpnI + XbaI (6kb + 2.35kb)
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 24 G>T, 819 G>A and 1323 T>C not causing the amino acid variation.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Human ITGB2 Gene Plasmid Map
Human Integrin beta2 natural ORF mammalian expression plasmid, C-Flag tag
Human ITGB2 Gene Expression validated Image
Human Integrin beta2 ORF mammalian expression plasmid, C-Flag tag
[Щелкните, чтобы увеличить изображение]
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Человек CD18/Integrin beta 2/ITGB2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
Человек CD18/Integrin beta 2/ITGB2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10970-ACGRBS16760
Человек CD18/Integrin beta 2/ITGB2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10970-ACRRBS16760
Человек CD18/Integrin beta 2/ITGB2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10970-CFRBS14710
Человек CD18/Integrin beta 2/ITGB2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10970-CHRBS14710
Человек CD18/Integrin beta 2/ITGB2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10970-CMRBS14710
Человек CD18/Integrin beta 2/ITGB2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10970-CYRBS14710
Человек CD18/Integrin beta 2/ITGB2 Джин клон кДНК в вектор клонированияHG10970-MRBS5130
Человек CD18/Integrin beta 2/ITGB2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10970-NFRBS14710
Человек CD18/Integrin beta 2/ITGB2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10970-NHRBS14710
Человек CD18/Integrin beta 2/ITGB2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10970-NMRBS14710
Человек CD18/Integrin beta 2/ITGB2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10970-NYRBS14710
Человек CD18/Integrin beta 2/ITGB2 Джин ORF экспрессии кДНК клона плазмидыHG10970-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG10970-CF
Цена по прейскуранту: 
Цена:      (You Save: )
НаличиеIn Stock
Запрос по оптовому заказуДобавить в корзину
Contact Us
  • Human Integrin beta2 ORF mammalian expression plasmid, C-Flag tag
  • Human Integrin beta2 natural ORF mammalian expression plasmid, C-Flag tag
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.