Быстрый заказ

Text Size:AAA

Человек LFA-1/CD11a/ITGAL/Integrin alpha L Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human ITGAL Информация о продукте «Клон cDNA»
Размер кДНК:3513bp
Описание кДНК:Full length Clone DNA of Homo sapiens integrin, alpha L (antigen CD11A (p180), lymphocyte function-associated antigen 1; alpha polypeptide) with N terminal Myc tag.
Синоним гена:CD11A, LFA-1, LFA1A, ITGAL
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Человек LFA-1/CD11a/ITGAL/Integrin alpha L Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Человек LFA-1/CD11a/ITGAL/Integrin alpha L Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10812-ACGRBS25660
Человек LFA-1/CD11a/ITGAL/Integrin alpha L Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10812-ACRRBS25660
Человек LFA-1/CD11a/ITGAL/Integrin alpha L Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10812-CFRBS23610
Человек LFA-1/CD11a/ITGAL/Integrin alpha L Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10812-CHRBS23610
Человек LFA-1/CD11a/ITGAL/Integrin alpha L Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10812-CMRBS23610
Человек LFA-1/CD11a/ITGAL/Integrin alpha L Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10812-CYRBS23610
Человек LFA-1/CD11a/ITGAL/Integrin alpha L Джин клон кДНК в вектор клонированияHG10812-MRBS5130
Человек LFA-1/CD11a/ITGAL/Integrin alpha L Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10812-M-FRBS23610
Человек LFA-1/CD11a/ITGAL/Integrin alpha L Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10812-NFRBS23610
Человек LFA-1/CD11a/ITGAL/Integrin alpha L Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10812-NHRBS23610
Человек LFA-1/CD11a/ITGAL/Integrin alpha L Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10812-NMRBS23610
Человек LFA-1/CD11a/ITGAL/Integrin alpha L Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10812-NYRBS23610
Человек LFA-1/CD11a/ITGAL/Integrin alpha L Джин ORF экспрессии кДНК клона плазмидыHG10812-UTRBS23610
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG10812-NM
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.