Быстрый заказ

Человек ITK Kinase Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human ITK Информация о продукте «Клон cDNA»
Размер кДНК:1863bp
Описание кДНК:Full length Clone DNA of Homo sapiens IL2-inducible T-cell kinase with N terminal His tag.
Синоним гена:ITK, EMT, LYK, PSCTK2, MGC126257, MGC126258
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Человек ITK Kinase Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Человек ITK Kinase Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10104-ACGRBS16760
Человек ITK Kinase Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10104-ACRRBS16760
Человек ITK Kinase Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG10104-ANGRBS16760
Человек ITK Kinase Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG10104-ANRRBS16760
Человек ITK Kinase Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10104-CFRBS14710
Человек ITK Kinase Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10104-CHRBS14710
Человек ITK Kinase Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10104-CMRBS14710
Человек ITK Kinase Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10104-CYRBS14710
Человек ITK Kinase Джин клон кДНК в вектор клонированияHG10104-MRBS5130
Человек ITK Kinase Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10104-NFRBS14710
Человек ITK Kinase Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10104-NHRBS14710
Человек ITK Kinase Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10104-NMRBS14710
Человек ITK Kinase Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10104-NYRBS14710
Человек ITK Kinase Джин ORF экспрессии кДНК клона плазмидыHG10104-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name

IL-2-inducible T cell kinase is a member of the protein kinase superfamily, Tyr protein kinase family and TEC subfamily. It contains 1 Btk-type zinc finger, 1 PH domain, 1 protein kinase domain, 1 SH2 domain and 1 SH3 domain. As an intracellular kinase which expressed in T-cells, IL-2-inducible T cell kinase contains both SH2 and SH3 domains which are often found in intracellular kinases. It is hought to play a role in T-cell proliferation and differentiation. It regulates the development, function and differentiation of conventional T-cells and nonconventional NKT-cells. IL-2-inducible T cell kinase also plays an essential role in regulation of the adaptive immune response. efects in IL-2-inducible T cell kinase are the cause of lymphoproliferative syndrome EBV-associated autosomal type 1 (LPSA1). LPSA1 is a rare immunodeficiency characterized by extreme susceptibility to infection with Epstein-Barr virus (EBV). Inadequate immune response to EBV can have a fatal outcome. Clinical features include splenomegaly, lymphadenopathy, anemia, thrombocytopenia, pancytopenia, recurrent infections. There is an increased risk for lymphoma.

  • Lee SH, et al. (2011) The association of a single-nucleotide polymorphism of the IL-2 inducible T-cell Kinase gene with asthma. Ann Hum Genet. 75(3):359-69.
  • Yao HL, et al. (2010) Effect of Itk down regulation on cytokines production in Jurkat cell. Zhonghua Shi Yan He Lin Chuang Bing Du Xue Za Zhi. 24(5):358-61.
  • Pechloff K, et al. (2010) The fusion kinase ITK-SYK mimics a T cell receptor signal and drives oncogenesis in conditional mouse models of peripheral T cell lymphoma. J Exp Med. 207(5):1031-44.
  • Size / Price
    Каталог: HG10104-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.