After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Человек ITK Kinase Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human ITK Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_005546.3
Размер кДНК:1863bp
Описание кДНК:Full length Clone DNA of Homo sapiens IL2-inducible T-cell kinase with N terminal His tag.
Синоним гена:ITK, EMT, LYK, PSCTK2, MGC126257, MGC126258
Виды:Human
переносчик:pCMV3-N-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Человек ITK Kinase Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Человек ITK Kinase Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10104-ACGRBS16760
Человек ITK Kinase Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10104-ACRRBS16760
Человек ITK Kinase Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG10104-ANGRBS16760
Человек ITK Kinase Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG10104-ANRRBS16760
Человек ITK Kinase Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10104-CFRBS14710
Человек ITK Kinase Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10104-CHRBS14710
Человек ITK Kinase Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10104-CMRBS14710
Человек ITK Kinase Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10104-CYRBS14710
Человек ITK Kinase Джин клон кДНК в вектор клонированияHG10104-MRBS5130
Человек ITK Kinase Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10104-NFRBS14710
Человек ITK Kinase Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10104-NHRBS14710
Человек ITK Kinase Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10104-NMRBS14710
Человек ITK Kinase Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10104-NYRBS14710
Человек ITK Kinase Джин ORF экспрессии кДНК клона плазмидыHG10104-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

IL-2-inducible T cell kinase is a member of the protein kinase superfamily, Tyr protein kinase family and TEC subfamily. It contains 1 Btk-type zinc finger, 1 PH domain, 1 protein kinase domain, 1 SH2 domain and 1 SH3 domain. As an intracellular kinase which expressed in T-cells, IL-2-inducible T cell kinase contains both SH2 and SH3 domains which are often found in intracellular kinases. It is hought to play a role in T-cell proliferation and differentiation. It regulates the development, function and differentiation of conventional T-cells and nonconventional NKT-cells. IL-2-inducible T cell kinase also plays an essential role in regulation of the adaptive immune response. efects in IL-2-inducible T cell kinase are the cause of lymphoproliferative syndrome EBV-associated autosomal type 1 (LPSA1). LPSA1 is a rare immunodeficiency characterized by extreme susceptibility to infection with Epstein-Barr virus (EBV). Inadequate immune response to EBV can have a fatal outcome. Clinical features include splenomegaly, lymphadenopathy, anemia, thrombocytopenia, pancytopenia, recurrent infections. There is an increased risk for lymphoma.

Ссылки
  • Lee SH, et al. (2011) The association of a single-nucleotide polymorphism of the IL-2 inducible T-cell Kinase gene with asthma. Ann Hum Genet. 75(3):359-69.
  • Yao HL, et al. (2010) Effect of Itk down regulation on cytokines production in Jurkat cell. Zhonghua Shi Yan He Lin Chuang Bing Du Xue Za Zhi. 24(5):358-61.
  • Pechloff K, et al. (2010) The fusion kinase ITK-SYK mimics a T cell receptor signal and drives oncogenesis in conditional mouse models of peripheral T cell lymphoma. J Exp Med. 207(5):1031-44.
  • Size / Price
    Каталог: HG10104-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».