After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Человек ITIH2 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human ITIH2 Информация о продукте «Клон cDNA»
Размер кДНК:2841bp
Описание кДНК:Full length Clone DNA of Homo sapiens inter-alpha-trypsin inhibitor heavy chain 2 with N terminal His tag.
Синоним гена:H2P, SHAP, ITIH2
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Человек ITIH2 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Человек ITIH2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13682-ACGRBS22240
Человек ITIH2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13682-ACRRBS22240
Человек ITIH2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13682-CFRBS20190
Человек ITIH2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13682-CHRBS20190
Человек ITIH2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13682-CMRBS20190
Человек ITIH2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13682-CYRBS20190
Человек ITIH2 Джин клон кДНК в вектор клонированияHG13682-GRBS5130
Человек ITIH2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13682-NFRBS20190
Человек ITIH2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13682-NHRBS20190
Человек ITIH2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13682-NMRBS20190
Человек ITIH2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13682-NYRBS20190
Человек ITIH2 Джин ORF экспрессии кДНК клона плазмидыHG13682-UTRBS20190
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG13682-NH
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.