Быстрый заказ

Человек ITGA7/Integrin alpha 7 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human ITGA7 Информация о продукте «Клон cDNA»
Размер кДНК:3426bp
Описание кДНК:Full length Clone DNA of Homo sapiens integrin, alpha 7 with C terminal HA tag.
Синоним гена:ITGA7
Участок рестрикции:KpnI + XbaI (6kb + 3.48kb)
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Human ITGA7 Gene Plasmid Map
Human ITGA7 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Человек ITGA7/Integrin alpha 7 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Человек ITGA7/Integrin alpha 7 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13425-ACGRBS25660
Человек ITGA7/Integrin alpha 7 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13425-ACRRBS22240
Человек ITGA7/Integrin alpha 7 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13425-CFRBS20190
Человек ITGA7/Integrin alpha 7 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13425-CHRBS20190
Человек ITGA7/Integrin alpha 7 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13425-CMRBS20190
Человек ITGA7/Integrin alpha 7 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13425-CYRBS20190
Человек ITGA7/Integrin alpha 7 Джин клон кДНК в вектор клонированияHG13425-GRBS5130
Человек ITGA7/Integrin alpha 7 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13425-NFRBS20190
Человек ITGA7/Integrin alpha 7 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13425-NHRBS20190
Человек ITGA7/Integrin alpha 7 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13425-NMRBS20190
Человек ITGA7/Integrin alpha 7 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13425-NYRBS20190
Человек ITGA7/Integrin alpha 7 Джин ORF экспрессии кДНК клона плазмидыHG13425-UTRBS20190
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG13425-CY
Цена по прейскуранту: 
Цена:      (You Save: )
НаличиеIn Stock
Запрос по оптовому заказуДобавить в корзину
Contact Us
  • Human ITGA7 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.