Быстрый заказ

Человек IST1 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Человек IST1 Информация о продукте «Клон cDNA»
Размер кДНК:1101bp
Описание кДНК:Full length Clone DNA of Homo sapiens increased sodium tolerance 1 homolog (yeast) with C terminal His tag.
Синоним гена:OLC1
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
( We provide with IST1 qPCR primers for gene expression analysis, HP105098 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Человек IST1 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Человек IST1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG16345-ACGRBS15400
Человек IST1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG16345-ACRRBS15400
Человек IST1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG16345-ANGRBS15400
Человек IST1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG16345-ANRRBS15400
Человек IST1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG16345-CFRBS13340
Человек IST1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG16345-CHRBS13340
Человек IST1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG16345-CMRBS13340
Человек IST1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG16345-CYRBS13340
Человек IST1 Джин клон кДНК в вектор клонированияHG16345-GRBS5130
Человек IST1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG16345-NFRBS13340
Человек IST1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG16345-NHRBS13340
Человек IST1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG16345-NMRBS13340
Человек IST1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG16345-NYRBS13340
Человек IST1 Джин ORF экспрессии кДНК клона плазмидыHG16345-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG16345-CH
Цена по прейскуранту: 
Цена:      (You Save: )
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.