ISCA2/HBLD1 cDNA ORF Clone, Human, untagged

Cat: HG14928-UT

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All ISCA2/HBLD1 Reagents

CRO Services

Product recommended


All ISCA2/HBLD1 Reagents

ISCA2/HBLD1 cDNA ORF Clone, Human, untagged General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
465 bp
Description
Full length Clone DNA of Human iron-sulfur cluster assembly 2 homolog (S. cerevisiae).

Plasmid

Promoter
Enhanced CMV promoter
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ISCA2/HBLD1 cDNA ORF Clone, Human, untagged Alternative Names

c14_5557 cDNA ORF Clone, Human;HBLD1 cDNA ORF Clone, Human;ISA2 cDNA ORF Clone, Human

ISCA2/HBLD1 Background Information

Full Name
iron-sulfur cluster assembly 2

ISCA2/HBLD1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
ISCA2/HBLD1 cDNA ORF Clone in Cloning Vector, Mouse MG54673-U
ISCA2/HBLD1 cDNA ORF Clone, Mouse, untagged MG54673-UT
ISCA2/HBLD1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG54673-ACG
ISCA2/HBLD1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG54673-ACGLN
ISCA2/HBLD1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG54673-ANG
ISCA2/HBLD1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG54673-ACR
ISCA2/HBLD1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG54673-ANR
ISCA2/HBLD1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG54673-CF
ISCA2/HBLD1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG54673-NF
ISCA2/HBLD1 cDNA ORF Clone, Mouse, C-His tag MG54673-CH
ISCA2/HBLD1 cDNA ORF Clone, Mouse, N-His tag MG54673-NH
ISCA2/HBLD1 cDNA ORF Clone, Mouse, C-HA tag MG54673-CY
ISCA2/HBLD1 cDNA ORF Clone, Mouse, N-HA tag MG54673-NY
ISCA2/HBLD1 cDNA ORF Clone, Mouse, C-Myc tag MG54673-CM
ISCA2/HBLD1 cDNA ORF Clone, Mouse, N-Myc tag MG54673-NM

ISCA2/HBLD1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
ISCA2/HBLD1 cDNA ORF Clone in Cloning Vector, Human HG14928-G
ISCA2/HBLD1 cDNA ORF Clone, Human, C-GFPSpark® tag HG14928-ACG
ISCA2/HBLD1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14928-ACGLN
ISCA2/HBLD1 cDNA ORF Clone, Human, N-GFPSpark® tag HG14928-ANG
ISCA2/HBLD1 cDNA ORF Clone, Human, C-OFPSpark® tag HG14928-ACR
ISCA2/HBLD1 cDNA ORF Clone, Human, N-OFPSpark® tag HG14928-ANR
ISCA2/HBLD1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14928-CF
ISCA2/HBLD1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14928-NF
ISCA2/HBLD1 cDNA ORF Clone, Human, C-His tag HG14928-CH
ISCA2/HBLD1 cDNA ORF Clone, Human, N-His tag HG14928-NH
ISCA2/HBLD1 cDNA ORF Clone, Human, C-HA tag HG14928-CY
ISCA2/HBLD1 cDNA ORF Clone, Human, N-HA tag HG14928-NY
ISCA2/HBLD1 cDNA ORF Clone, Human, C-Myc tag HG14928-CM
ISCA2/HBLD1 cDNA ORF Clone, Human, N-Myc tag HG14928-NM
ISCA2/HBLD1 qPCR Primer Pairs, Human HP103557
info info
添加购物车成功! 添加购物车失败!