After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек Inhibin beta B/INHBB Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human INHBB Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_002193.2
Размер кДНК:1224bp
Описание кДНК:Full length Clone DNA of Homo sapiens inhibin, beta B with N terminal Myc tag.
Синоним гена:MGC157939, INHBB
Виды:Human
переносчик:pCMV3-SP-N-Myc
Plasmid:
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Человек Inhibin beta B/INHBB Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Человек Inhibin beta B/INHBB Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10814-ACGRBS15400
Человек Inhibin beta B/INHBB Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10814-ACRRBS15400
Человек Inhibin beta B/INHBB Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10814-CFRBS13340
Человек Inhibin beta B/INHBB Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10814-CHRBS13340
Человек Inhibin beta B/INHBB Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10814-CMRBS13340
Человек Inhibin beta B/INHBB Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10814-CYRBS13340
Человек Inhibin beta B/INHBB Джин клон кДНК в вектор клонированияHG10814-MRBS5130
Человек Inhibin beta B/INHBB Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10814-NFRBS13340
Человек Inhibin beta B/INHBB Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10814-NHRBS13340
Человек Inhibin beta B/INHBB Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10814-NMRBS13340
Человек Inhibin beta B/INHBB Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10814-NYRBS13340
Человек Inhibin beta B/INHBB Джин ORF экспрессии кДНК клона плазмидыHG10814-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Activin and inhibin are two closely related protein complexes that have almost directly opposite biological effects. The activin and inhibin protein complexes are both dimeric in structure, and, in each complex, the two monomers are linked to one another by a single disulfide bond. Activin is composed of two ß subunits, ßA ßA (activin A), ßB ßB (activin B), or ßA ßB (activin AB). Inhibin is composed of an alpha and one of two ß subunits, ßA (inhibin A) or ßB (inhibin B). Activins are produced in many cell types and organs, such as gonads, pituitary gland, and placenta. In the ovarian follicle, activin increases FSH binding and FSH-induced aromatization. It participates in androgen synthesis enhancing LH action in the ovary and testis. In the male, activin enhances spermatogenesis. In addition, Activin plays a role in wound repair and skin morphogenesis. Activin is strongly expressed in wounded skin, and overexpression of activin in epidermis of transgenic mice improves wound healing and enhances scar formation. Activin also regulates the morphogenesis of branching organs such as the prostate, lung, and kidney. There is also evidence showed that lack of activin during development results in neural developmental defects.

Ссылки
  • Feng ZM, et al. (1989) Characterization and regulation of testicular inhibin beta-subunit mRNA. Mol Endocrinol. 3 (6): 939-48.
  • Bernard DJ, et al. (2002) Inhibin binding protein (InhBP/p120), betaglycan, and the continuing search for the inhibin receptor. Mol Endocrinol. 16 (2): 207-12.
  • Lejeune H, et al. (1997) Stimulating effect of both human recombinant inhibin A and activin A on immature porcine Leydig cell functions in vitro. Endocrinology. 138 (11): 4783-91.
  • Size / Price
    Каталог: HG10814-NM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».