After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Человек ING4 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human ING4 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC007781
Размер кДНК:750bp
Описание кДНК:Full length Clone DNA of Homo sapiens inhibitor of growth family, member 4.
Синоним гена:My036, MGC12557, my036, p29ING4, ING4
Виды:Human
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек ING4 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек ING4 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14264-ACGRBS15400
Человек ING4 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14264-ACRRBS15400
Человек ING4 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG14264-ANGRBS15400
Человек ING4 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG14264-ANRRBS15400
Человек ING4 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14264-CFRBS13340
Человек ING4 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14264-CHRBS13340
Человек ING4 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14264-CMRBS13340
Человек ING4 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14264-CYRBS13340
Человек ING4 Джин клон кДНК в вектор клонированияHG14264-GRBS5130
Человек ING4 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14264-NFRBS13340
Человек ING4 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14264-NHRBS13340
Человек ING4 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14264-NMRBS13340
Человек ING4 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14264-NYRBS13340
Человек ING4 Джин ORF экспрессии кДНК клона плазмидыHG14264-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

ING4 is similar to ING1, a tumor suppressor protein that can interact with TP53, inhibit cell growth, and induce apoptosis. ING4 contains a PHD-finger, which is a common motif in proteins involved in chromatin remodeling. ING4 protein can bind TP53 and EP300/p300, a component of the histone acetyl transferase complex, suggesting its involvement in the TP53-dependent regulatory pathway. ING4 is a component of the HBO1 complex which has a histone H4-specific acetyltransferase activity, a reduced activity toward histone H3 and is responsible for the bulk of histone H4 acetylation in vivo. Through chromatin acetylation it may function in DNA replication. ING4 may also inhibit tumor progression by modulating the transcriptional output of signaling pathways which regulate cell proliferation.

Ссылки
  • Shiseki M. et al., 2003, Cancer Res. 63 (10): 2373-8.
  • Garkavtsev. et al., 2004, Nature. 428 (6980): 328-32.
  • Tsai. et al., 2008, Exp Cell Res. 314 (17): 3130-41.
  • Size / Price
    Каталог: HG14264-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».