Быстрый заказ

Человек ING4 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек ING4 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:BC007781
    Размер кДНК:750bp
    Описание кДНК:Full length Clone DNA of Homo sapiens inhibitor of growth family, member 4 with N terminal His tag.
    Синоним гена:My036, MGC12557, my036, p29ING4, ING4
    Виды:Human
    переносчик:pCMV3-N-His
    Plasmid:
    Участок рестрикции:
    Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with ING4 qPCR primers for gene expression analysis, HP102914 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Человек ING4 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
    Человек ING4 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14264-ACGRBS15400
    Человек ING4 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14264-ACRRBS15400
    Человек ING4 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG14264-ANGRBS15400
    Человек ING4 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG14264-ANRRBS15400
    Человек ING4 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14264-CFRBS13340
    Человек ING4 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14264-CHRBS13340
    Человек ING4 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14264-CMRBS13340
    Человек ING4 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14264-CYRBS13340
    Человек ING4 Джин клон кДНК в вектор клонированияHG14264-GRBS5130
    Человек ING4 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14264-NFRBS13340
    Человек ING4 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14264-NHRBS13340
    Человек ING4 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14264-NMRBS13340
    Человек ING4 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14264-NYRBS13340
    Человек ING4 Джин ORF экспрессии кДНК клона плазмидыHG14264-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Фон

    ING4 is similar to ING1, a tumor suppressor protein that can interact with TP53, inhibit cell growth, and induce apoptosis. ING4 contains a PHD-finger, which is a common motif in proteins involved in chromatin remodeling. ING4 protein can bind TP53 and EP300/p300, a component of the histone acetyl transferase complex, suggesting its involvement in the TP53-dependent regulatory pathway. ING4 is a component of the HBO1 complex which has a histone H4-specific acetyltransferase activity, a reduced activity toward histone H3 and is responsible for the bulk of histone H4 acetylation in vivo. Through chromatin acetylation it may function in DNA replication. ING4 may also inhibit tumor progression by modulating the transcriptional output of signaling pathways which regulate cell proliferation.

    Ссылки
  • Shiseki M. et al., 2003, Cancer Res. 63 (10): 2373-8.
  • Garkavtsev. et al., 2004, Nature. 428 (6980): 328-32.
  • Tsai. et al., 2008, Exp Cell Res. 314 (17): 3130-41.
  • Size / Price
    Каталог: HG14264-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».