After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек IL3RA/CD123 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human IL3RA Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_002183.2
Размер кДНК:1137bp
Описание кДНК:Full length Clone DNA of Homo sapiens interleukin 3 receptor, alpha (low affinity) with N terminal HA tag.
Синоним гена:IL3R, CD123, IL3RX, IL3RY, IL3RAY, hIL-3Ra, MGC34174
Виды:Human
переносчик:pCMV3-SP-N-HA
Plasmid:
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Человек IL3RA/CD123 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
Человек IL3RA/CD123 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10518-ACGRBS15400
Человек IL3RA/CD123 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10518-ACRRBS15400
Человек IL3RA/CD123 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10518-CFRBS13340
Человек IL3RA/CD123 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10518-CHRBS13340
Человек IL3RA/CD123 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10518-CMRBS13340
Человек IL3RA/CD123 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10518-CYRBS13340
Человек IL3RA/CD123 Джин клон кДНК в вектор клонированияHG10518-MRBS5130
Человек IL3RA/CD123 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10518-NFRBS13340
Человек IL3RA/CD123 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10518-NHRBS13340
Человек IL3RA/CD123 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10518-NMRBS13340
Человек IL3RA/CD123 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10518-NYRBS13340
Человек IL3RA/CD123 Джин ORF экспрессии кДНК клона плазмидыHG10518-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Interleukin-3 receptor subunit alpha, also known as IL-3 receptor subunit alpha, IL-3R-alpha, CD123, and IL3RA, is a single-pass type I membrane protein which belongs to the type I cytokine receptor family and Type 5 subfamily. The specific alpha subunit of the interleukin-3 receptor (IL-3Ralpha, CD123) is strongly expressed in various leukemic blasts and leukemic stem cells and seems to be an excellent target for the therapy of leukemias. The WSXWS motif of IL3RA appears to be necessary for proper protein folding and thereby efficient intracellular transport and cell-surface receptor binding. The box one motif of IL3RA is required for JAK interaction and / or activation. IL3RA represents a unique marker for primitive leukemic stem cells. Targeting of IL3RA may be a promising strategy for the preferential ablation of AML cells. Aberrant IL3RA expression is a good marker for monitoring of minimal residual disease. IL3RA is strongly expressed in various leukemic blasts and leukemic stem cells and seems to be an excellent target for the therapy of leukemias. Recent studies have shown that interleukin-3 receptor alpha (CD123) is highly expressed on leukemia stem cells of patients with acute myeloid leukemia, and is correlated with tumor load and poor prognosis. CD123 was highly expressed in the bone marrow of the patients with myelodysplastic syndrome (MDS), significantly correlated with the proportion of bone marrow blasts, and thus might be the marker of MDS malignant clone. IL3RA is also a useful new marker for distinguishing B-cell disorders with circulating villous lymphocytes as its expression is characteristic of typical hairy cell leukemia (HCL) with high sensitivity and specificity.

Ссылки
  • Del Giudice I, et al. (2004) The diagnostic value of CD123 in B-cell disorders with hairy or villous lymphocytes. Haematologica. 89(3): 303-8.
  • Du X, et al. (2007) New immunotoxins targeting CD123, a stem cell antigen on acute myeloid leukemia cells. J Immunother. 30(6): 607-13.
  • Yue LZ, et al. (2010) Expression of CD123 and CD114 on the bone marrow cells of patients with myelodysplastic syndrome. Chin Med J (Engl). 123(15): 2034-2037.
  • Size / Price
    Каталог: HG10518-NY
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».