Быстрый заказ

Человек IL36B/IL1F8 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human IL36B Информация о продукте «Клон cDNA»
Размер кДНК:474bp
Описание кДНК:Full length Clone DNA of Homo sapiens interleukin 1 family, member 8 (eta), transcript variant 2 with C terminal Myc tag.
Синоним гена:FIL1, FIL1H, IL1H2, IL-1F8, IL-1H2, IL1-ETA, MGC126880, MGC126882, FIL1-(ETA)
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Человек IL36B/IL1F8 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка on other vectors
Человек IL36B/IL1F8 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10579-ACGRBS15400
Человек IL36B/IL1F8 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10579-ACRRBS15400
Человек IL36B/IL1F8 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10579-CFRBS13340
Человек IL36B/IL1F8 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10579-CHRBS13340
Человек IL36B/IL1F8 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10579-CMRBS13340
Человек IL36B/IL1F8 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10579-CYRBS13340
Человек IL36B/IL1F8 transcript variant 2 Джин клон кДНК в вектор клонированияHG10579-MRBS5130
Человек IL36B/IL1F8 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10579-M-FRBS13340
Человек IL36B/IL1F8 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10579-NFRBS13340
Человек IL36B/IL1F8 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10579-NHRBS13340
Человек IL36B/IL1F8 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10579-NMRBS13340
Человек IL36B/IL1F8 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10579-NYRBS13340
Человек IL36B/IL1F8 transcript variant 2 Джин ORF экспрессии кДНК клона плазмидыHG10579-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Interleukin-1 family member 8(IL1F8) also known as IL36B, is a member of the interleukin 1(IL-1) cytokine family. IL1F8 may contains a 12-stranded beta-trefoil structure. Until recently, the IL-1 family of cytokines includ four members, with three having pro-inflammatory effects such as IL1F8 and the fourth member being an IL-1 receptor antagonist (IL-1Ra). IL-1 family members exert their effects through binding to receptors that belong to the IL-1 receptor (IL-1R) family. IL1F8 exerts proinflammatory effects in primary human joint cells. Joint and serum IL-1F8 protein levels did not correlate with inflammation, but they were high in some human serum samples tested, including samples from patients with rheumatoid arthritis. IL1F8 also activated NK-κB.

  • Magne D, et al. (2006) The new IL-1 family member IL-1F8 stimulates production of inflammatory mediators by synovial fibroblasts and articular chondrocytes. Arthritis Research & Therapy. 8: R80.
  • Smith DE, et al. (2000) The new IL-1 family member IL-1F8 stimulates production of inflammatory mediators by synovial fibroblasts and articular chondrocytes. The Journal of Biological Chemistry. 275: 1169-75.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.