Быстрый заказ

Человек IL1RL1/IL‑1 R4 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human IL1RL1 Информация о продукте «Клон cDNA»
Размер кДНК:987bp
Описание кДНК:Full length Clone DNA of Homo sapiens interleukin 1 receptor-like 1, transcript variant 2 with N terminal His tag.
Синоним гена:IL1RL1, T1, ST2, DER4, ST2L, ST2V, FIT-1, MGC32623
Участок рестрикции:KpnI + NotI (6kb + 1.03kb)
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Human IL1RL1 Gene Plasmid Map
Human IL1RL1 / ST2 transcript variant 2 natural ORF mammalian expression plasmid, N-His tag
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Человек IL1RL1/IL‑1 R4 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Человек IL1RL1/IL‑1 R4 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10105-ACGRBS15400
Человек IL1RL1/IL‑1 R4 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10105-ACRRBS15400
Человек IL1RL1/IL‑1 R4 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10105-CFRBS13340
Человек IL1RL1/IL‑1 R4 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10105-CHRBS13340
Человек IL1RL1/IL‑1 R4 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10105-CMRBS13340
Человек IL1RL1/IL‑1 R4 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10105-CYRBS13340
Человек IL1RL1/IL‑1 R4 transcript variant 2 Джин клон кДНК в вектор клонированияHG10105-MRBS5130
Человек IL1RL1/IL‑1 R4 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10105-NFRBS13340
Человек IL1RL1/IL‑1 R4 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10105-NHRBS13340
Человек IL1RL1/IL‑1 R4 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10105-NMRBS13340
Человек IL1RL1/IL‑1 R4 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10105-NYRBS13340
Человек IL1RL1/IL‑1 R4 transcript variant 2 Джин ORF экспрессии кДНК клона плазмидыHG10105-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

IL-1 receptor–like 1 (IL1RL1) is a membrane receptor involved in TH2 inflammatory responses and eosinophilia. It has previously been described that levels of the interlukin-1 like 1 (IL1RL1) protein can be used to diagnose cardiovascular disease and determine the prognosis for a patient with cardiovascular disease. The ligand for IL1RL1 has been described, and named IL-33. Mutants in IL1RL1 have been associated with blood eosinophil counts in a genome-wide association study and with asthma in family-based and case-control studies. As an important mediator involved in many immune and inflammatory responses, this cytokine has been implicated as a regulator of both the development and effector phases of type 2 helper T cell responses, and as a negative feedback modulator of macrophage pro-inflammatory function. IL33 is a specific ligand of ST2L and induces production of Th2 cytokines.

  • Savenije OE, et al. (2011) Interleukin-1 receptor-like 1 polymorphisms are associated with serum IL1RL1-a, eosinophils, and asthma in childhood. J Allergy Clin Immunol. 127(3): 750-6.
  • Li H, et al. (2000) The cloning and nucleotide sequence of human ST2L cDNA. Genomics. 67(3): 284-90.
  • Size / Price
    Каталог: HG10105-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    НаличиеIn Stock
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    • Human IL1RL1 / ST2 transcript variant 2 natural ORF mammalian expression plasmid, N-His tag
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.