Быстрый заказ

Человек IL-1R9/IL1RAPL2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human IL1RAPL2 Информация о продукте «Клон cDNA»
Размер кДНК:2061bp
Описание кДНК:Full length Clone DNA of Homo sapiens interleukin 1 receptor accessory protein-like 2 (IL1RAPL2) with N terminal Myc tag.
Синоним гена:IL1RAPL2, IL1R9, IL-1R9, TIGIRR-1, IL1RAPL-2
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Человек IL-1R9/IL1RAPL2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Человек IL-1R9/IL1RAPL2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10156-ACGRBS16760
Человек IL-1R9/IL1RAPL2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10156-ACRRBS16760
Человек IL-1R9/IL1RAPL2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10156-CFRBS14710
Человек IL-1R9/IL1RAPL2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10156-CHRBS14710
Человек IL-1R9/IL1RAPL2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10156-CMRBS14710
Человек IL-1R9/IL1RAPL2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10156-CYRBS14710
Человек IL-1R9/IL1RAPL2 Джин клон кДНК в вектор клонированияHG10156-MRBS5130
Человек IL-1R9/IL1RAPL2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10156-M-FRBS14710
Человек IL-1R9/IL1RAPL2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10156-NFRBS14710
Человек IL-1R9/IL1RAPL2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10156-NHRBS14710
Человек IL-1R9/IL1RAPL2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10156-NMRBS14710
Человек IL-1R9/IL1RAPL2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10156-NYRBS14710
Человек IL-1R9/IL1RAPL2 Джин ORF экспрессии кДНК клона плазмидыHG10156-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name

X-linked interleukin-1 receptor accessory protein-like 2 (IL1RAPL2) or Interleukin-1 receptor 9 (IL-1R9) is a member of the interleukin 1 receptor family. This protein is similar to the interleukin 1 accessory proteins. IL-1R9/IL1RAPL2 shows restricted expression in fetal brain and is highly homologous to IL1RAPL, which is reportedly involved in nonsyndromic X-linked mental retardation. IL-1R9/IL1RAPL2 is highly homologous to IL-1R8. Both forms have no known ligands and receptor are found in the fetal brain. IL-1R9/IL1RAPL2 may function as a negative receptor. Both IL1RAPL1 and IL1RAPL2 have novel C-terminal sequences not present in other related proteins. IL-1R9/IL1RAPL2 may be strong candidates for X-linked non-syndromic mental retardation loci, and that molecules resembling IL-1 and IL-18 play a role in the development or function of the central nervous system.

  • Jin H, et al. (2000) Two novel members of the interleukin-1 receptor gene family, one deleted in Xp22.1-Xp21.3 mental retardation. Eur J Hum Genet. 8(2): 87-94.
  • Sana TR, et al. (2000) Computational identification, cloning, and characterization of IL-1R9, a novel interleukin-1 receptor-like gene encoded over an unusually large interval of human chromosome Xq22.2-q22.3. Genomics. 69(2): 252-62.
  • Gambino F, et al. (2007) IL1-receptor accessory protein-like 1 (IL1RAPL1), a protein involved in cognitive functions, regulates N-type Ca2+-channel and neurite elongation. Proc Natl Acad Sci. 104(21): 9063-8.
  • Size / Price
    Каталог: HG10156-NM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.