Быстрый заказ

Человек IL-1R2/CD121b transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human IL1R2 Информация о продукте «Клон cDNA»
Размер кДНК:1197bp
Описание кДНК:Full length Clone DNA of Homo sapiens interleukin 1 receptor, type I I, transcript variant 1 with N terminal His tag.
Синоним гена:IL1R2, IL1RB, CD121b, MGC47725
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Человек IL-1R2/CD121b transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Человек IL-1R2/CD121b transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10111-ACGRBS15400
Человек IL-1R2/CD121b transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10111-ACRRBS15400
Человек IL-1R2/CD121b transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10111-CFRBS13340
Человек IL-1R2/CD121b transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10111-CHRBS13340
Человек IL-1R2/CD121b transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10111-CMRBS13340
Человек IL-1R2/CD121b transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10111-CYRBS13340
Человек IL-1R2/CD121b transcript variant 1 Джин клон кДНК в вектор клонированияHG10111-MRBS5130
Человек IL-1R2/CD121b transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10111-M-FRBS13340
Человек IL-1R2/CD121b transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10111-NFRBS13340
Человек IL-1R2/CD121b transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10111-NHRBS13340
Человек IL-1R2/CD121b transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10111-NMRBS13340
Человек IL-1R2/CD121b transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10111-NYRBS13340
Человек IL-1R2/CD121b transcript variant 1 Джин ORF экспрессии кДНК клона плазмидыHG10111-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Interleukin 1 receptor, type II (IL1R2) also known as CD121b (Cluster of Differentiation 121b) is a cytokine receptor that belongs to the interleukin-1 receptor family. This protein binds interleukin alpha (IL1A), interleukin beta (IL1B), and interleukin 1 receptor, type I (IL1R1/IL1RA), and acts as a decoy receptor that inhibits the activity of its ligands. The pleiotropic cytokine IL1 is produced to regulate development and maintenance of the inflammatory responses, and binds to specific plasma membrane receptors on cells. Two distinct types of IL1 receptors which are able to bind IL1 specifically have been identified, designated as IL1RI (IL1RA) and IL1RII (IL1RB). IL1R1 contributes to IL-1 signaling, whereas the IL-1R2/CD121b has no signaling property and acts as a decoy for IL-1. IL-1R2/CD121b structurally consisting of a ligand binding portion comprised of three Ig-like domains, a single transmembrane region, and a short cytoplasmic domain, is expressed in a variety of cell types including B lymphocytes, neutrophils, monocytes, large granular leukocytes and endothelial cells. Interleukin 4 (IL4) is reported to antagonize the activity of interleukin 1 by inducing the expression and release of this cytokine.

  • Cannon JG, et al. (1997) Interleukin-1 beta, interleukin-1 receptor antagonist, and soluble interleukin-1 receptor type II secretion in chronic fatigue syndrome. J Clin Immunol. 17 (3): 253-61.
  • Liu C, et al. (1996) Cloning and characterization of an alternatively processed human type II interleukin-1 receptor mRNA. J Biol Chem. 271 (34): 20965-72.
  • Van der Poll T, et al. (1997) Antiinflammatory cytokine responses during clinical sepsis and experimental endotoxemia: sequential measurements of plasma soluble interleukin (IL)-1 receptor type II, IL-10, and IL-13. J Infect Dis. 175 (1): 118-22.
  • Size / Price
    Каталог: HG10111-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.