IL17RB cDNA ORF Clone, Human, N-Myc tag

Price:
Size:
Number:

IL17RB cDNA ORF Clone, Human, N-Myc tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1509 bp
Description
Full length Clone DNA of Human interleukin 17 receptor B with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

IL17RB cDNA ORF Clone, Human, N-Myc tag: Alternative Names

CRL4 cDNA ORF Clone, Human; EVI27 cDNA ORF Clone, Human; IL17BR cDNA ORF Clone, Human; IL17RH1 cDNA ORF Clone, Human

IL17RB Background Information

IL17RB is the receptor for IL17E, the only member of IL17 family promoting Th2 reactions. IL17RB is induced on human macrophages by IL4 and enhanced by TGFbeta. Overexpression of IL17RB is associated with poor prognosis and short survival of the breast cancer patients.IL17RB/IL17B signaling triggers a substantial increase in the cell growth, proliferation and migration through the activation of NF-kappaB as well as the up-regulation of the Bcl-2. IL17RB may be the only gene expressed in CD4+ T cells whose transcript measurement is correlated with the variation in IgE level in asthmatics.
Full Name
interleukin 17 receptor B
References
  • Rickel EA, et al.. (2008) Identification of functional roles for both IL-17RB and IL-17RA in mediating IL-25-induced activities. J Immunol. 181(6): 4299-310.
  • Stock P, et al.. (2009) Induction of airway hyperreactivity by IL-25 is dependent on a subset of invariant NKT cells expressing IL-17RB. J Immunol. 182(8): 5116-22.
  • Wang H, et al.. (2010) Allergen challenge of peripheral blood mononuclear cells from patients with seasonal allergic rhinitis increases IL-17RB, which regulates basophil apoptosis and degranulation. Clin Exp Allergy. 40(8): 1194-202.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait