Быстрый заказ

Text Size:AAA

Человек IL17BR / IL17RB / IL-17 Receptor B Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human IL17RB Информация о продукте «Клон cDNA»
Размер кДНК:1509bp
Описание кДНК:Full length Clone DNA of Homo sapiens interleukin 17 receptor B with N terminal Myc tag.
Синоним гена:CRL4, EVI27, IL17BR, IL17RH1, MGC5245
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Человек IL17BR / IL17RB / IL-17 Receptor B Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Человек IL17BR / IL17RB / IL-17 Receptor B Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13091-ACGRBS16760
Человек IL17BR / IL17RB / IL-17 Receptor B Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13091-ACRRBS16760
Человек IL17BR / IL17RB / IL-17 Receptor B Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13091-CFRBS14710
Человек IL17BR / IL17RB / IL-17 Receptor B Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13091-CHRBS14710
Человек IL17BR / IL17RB / IL-17 Receptor B Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13091-CMRBS14710
Человек IL17BR / IL17RB / IL-17 Receptor B Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13091-CYRBS14710
Человек IL17BR / IL17RB / IL-17 Receptor B Джин клон кДНК в вектор клонированияHG13091-MRBS5130
Человек IL17BR / IL17RB / IL-17 Receptor B Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13091-M-FRBS14710
Человек IL17BR / IL17RB / IL-17 Receptor B Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13091-NFRBS14710
Человек IL17BR / IL17RB / IL-17 Receptor B Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13091-NHRBS14710
Человек IL17BR / IL17RB / IL-17 Receptor B Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13091-NMRBS14710
Человек IL17BR / IL17RB / IL-17 Receptor B Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13091-NYRBS14710
Человек IL17BR / IL17RB / IL-17 Receptor B Джин ORF экспрессии кДНК клона плазмидыHG13091-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
  • Rickel EA, et al.. (2008) Identification of functional roles for both IL-17RB and IL-17RA in mediating IL-25-induced activities. J Immunol. 181(6): 4299-310.
  • Stock P, et al.. (2009) Induction of airway hyperreactivity by IL-25 is dependent on a subset of invariant NKT cells expressing IL-17RB. J Immunol. 182(8): 5116-22.
  • Wang H, et al.. (2010) Allergen challenge of peripheral blood mononuclear cells from patients with seasonal allergic rhinitis increases IL-17RB, which regulates basophil apoptosis and degranulation. Clin Exp Allergy. 40(8): 1194-202.
  • Size / Price
    Каталог: HG13091-NM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.