Быстрый заказ

Человек IL17BR / IL17RB / IL-17 Receptor B Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек IL17RB Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_018725.3
    Размер кДНК:1509bp
    Описание кДНК:Full length Clone DNA of Homo sapiens interleukin 17 receptor B with N terminal Myc tag.
    Синоним гена:CRL4, EVI27, IL17BR, IL17RH1, MGC5245
    Виды:Human
    переносчик:pCMV3-SP-N-Myc
    Plasmid:
    Участок рестрикции:
    Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with IL17RB qPCR primers for gene expression analysis, HP100209 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    Myc Tag Info

    A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

    The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

    Человек IL17BR / IL17RB / IL-17 Receptor B Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
    Человек IL17BR / IL17RB / IL-17 Receptor B Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13091-ACGRBS16760
    Человек IL17BR / IL17RB / IL-17 Receptor B Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13091-ACRRBS16760
    Человек IL17BR / IL17RB / IL-17 Receptor B Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13091-CFRBS14710
    Человек IL17BR / IL17RB / IL-17 Receptor B Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13091-CHRBS14710
    Человек IL17BR / IL17RB / IL-17 Receptor B Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13091-CMRBS14710
    Человек IL17BR / IL17RB / IL-17 Receptor B Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13091-CYRBS14710
    Человек IL17BR / IL17RB / IL-17 Receptor B Джин клон кДНК в вектор клонированияHG13091-MRBS5130
    Человек IL17BR / IL17RB / IL-17 Receptor B Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13091-M-FRBS14710
    Человек IL17BR / IL17RB / IL-17 Receptor B Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13091-NFRBS14710
    Человек IL17BR / IL17RB / IL-17 Receptor B Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13091-NHRBS14710
    Человек IL17BR / IL17RB / IL-17 Receptor B Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13091-NMRBS14710
    Человек IL17BR / IL17RB / IL-17 Receptor B Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13091-NYRBS14710
    Человек IL17BR / IL17RB / IL-17 Receptor B Джин ORF экспрессии кДНК клона плазмидыHG13091-UTRBS14710
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Ссылки
  • Rickel EA, et al.. (2008) Identification of functional roles for both IL-17RB and IL-17RA in mediating IL-25-induced activities. J Immunol. 181(6): 4299-310.
  • Stock P, et al.. (2009) Induction of airway hyperreactivity by IL-25 is dependent on a subset of invariant NKT cells expressing IL-17RB. J Immunol. 182(8): 5116-22.
  • Wang H, et al.. (2010) Allergen challenge of peripheral blood mononuclear cells from patients with seasonal allergic rhinitis increases IL-17RB, which regulates basophil apoptosis and degranulation. Clin Exp Allergy. 40(8): 1194-202.
  • Size / Price
    Каталог: HG13091-NM
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».