After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек IL17A/IL-17A/IL17 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human IL17A Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_002190
Размер кДНК:468bp
Описание кДНК:Full length Clone DNA of Homo sapiens interleukin 17A with C terminal His tag.
Синоним гена:IL-17A, IL-17
Виды:Human
переносчик:pCMV3-C-His
Plasmid:pCMV3-IL17A-His
Участок рестрикции:KpnI + XbaI (6kb + 0.51kb)
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Human IL17A Gene Plasmid Map
Human IL17A natural ORF mammalian expression plasmid, C-His tag
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Человек IL17A/IL-17A/IL17 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Человек IL17A/IL-17A/IL17 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG12047-ACGRBS15400
Человек IL17A/IL-17A/IL17 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG12047-ACRRBS15400
Человек IL17A/IL-17A/IL17 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG12047-CFRBS13340
Человек IL17A/IL-17A/IL17 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG12047-CHRBS13340
Человек IL17A/IL-17A/IL17 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG12047-CMRBS13340
Человек IL17A/IL-17A/IL17 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG12047-CYRBS13340
Человек IL17A/IL-17A/IL17 Джин клон кДНК в вектор клонированияHG12047-GRBS5130
Человек IL17A/IL-17A/IL17 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG12047-NFRBS13340
Человек IL17A/IL-17A/IL17 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG12047-NHRBS13340
Человек IL17A/IL-17A/IL17 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG12047-NMRBS13340
Человек IL17A/IL-17A/IL17 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG12047-NYRBS13340
Человек IL17A/IL-17A/IL17 Джин ORF экспрессии кДНК клона плазмидыHG12047-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

IL17, also known as IL17a, is a cytokine belongs to the IL-17 family. Cytokines are proteinaceous signaling compounds that are major mediators of the immune response. They control many different cellular functions including proliferation, differentiation and cell survival/apoptosis but are also involved in several pathophysiological processes including viral infections and autoimmune diseases. Cytokines are synthesized under various stimuli by a variety of cells of both the innate (monocytes, macrophages, dendritic cells) and adaptive (T- and B-cells) immune systems. The IL-17 family of cytokines includes six members, IL-17/IL-17A, IL-17B, IL-17C, IL-17D, IL-17E/IL-25, and IL-17F, which are produced by multiple cell types. IL-17 regulates the activities of NF-kappaB and mitogen-activated protein kinases. This cytokine can stimulate the expression of IL6 and cyclooxygenase-2 (PTGS2/COX-2), as well as enhance the production of nitric oxide (NO). High levels of IL-17 are associated with several chronic inflammatory diseases including rheumatoid arthritis, psoriasis and multiple sclerosis.

Ссылки
  • Andoh A, et al. (2002) IL-17 selectively down-regulates TNF-alpha-induced RANTES gene expression in human colonic subepithelial myofibroblasts. J Immunol. 169(4):1683-7.
  • Kotake S, et al. (1999) IL-17 in synovial fluids from patients with rheumatoid arthritis is a potent stimulator of osteoclastogenesis. J Clin Invest. 103(9):1345-52.
  • Laan M, et al. (1999) Neutrophil recruitment by human IL-17 via C-X-C chemokine release in the airways. J Immunol. 162(4):2347-52.
  • Shin HC, et al. (1999) Regulation of IL-17, IFN-gamma and IL-10 in human CD8(+) T cells by cyclic AMP-dependent signal transduction pathway. Cytokine. 10(11):841-50.
  • Size / Price
    Каталог: HG12047-CH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    НаличиеIn Stock
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
    • Human IL17A natural ORF mammalian expression plasmid, C-His tag
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».