After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек IL12RB2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human IL12RB2 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001559.2
Размер кДНК:2589bp
Описание кДНК:Full length Clone DNA of Homo sapiens interleukin 12 receptor, beta 2 with N terminal Myc tag.
Синоним гена:IL12RB2, RP11-102M16.1
Виды:Human
переносчик:pCMV3-SP-N-Myc
Plasmid:
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Человек IL12RB2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Человек IL12RB2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10145-ACGRBS22240
Человек IL12RB2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10145-ACRRBS22240
Человек IL12RB2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10145-CFRBS20190
Человек IL12RB2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10145-CHRBS20190
Человек IL12RB2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10145-CMRBS20190
Человек IL12RB2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10145-CYRBS20190
Человек IL12RB2 Джин клон кДНК в вектор клонированияHG10145-MRBS5130
Человек IL12RB2 Джин ORF экспрессии кДНК клона плазмидыHG10145-M-NRBS20190
Человек IL12RB2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10145-M-YRBS20190
Человек IL12RB2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10145-NFRBS20190
Человек IL12RB2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10145-NHRBS20190
Человек IL12RB2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10145-NMRBS20190
Человек IL12RB2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10145-NYRBS20190
Человек IL12RB2 Джин ORF экспрессии кДНК клона плазмидыHG10145-UTRBS20190
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Interleukin-12 receptor subunit beta-2 (IL12RB2), also known as IL-12 receptor subunit beta-2, IL-12R subunit beta-2, IL-12R-beta-2, and IL-12RB2, is a type I transmembrane protein identified as a subunit of the interleukin 12 receptor complex. IL12RB2 belongs to the type I cytokine receptor family. The coexpression of IL12RB2 and IL12RB1 proteins was shown to lead to the formation of high-affinity IL12 binding sites and reconstitution of IL12 dependent signaling. The expression of IL12RB2 is up-regulated by IFN gamma in Th1 cells, and plays a role in Th1 cell differentiation. The up-regulation of IL12RB2 is found to be associated with a number of infectious diseases, such as Crohn's disease and leprosy, which is thought to contribute to the inflammatory response and host defense. This subunit is the signaling component coupling to the JAK2/STAT4 pathway. IL12RB2 promotes the proliferation of T-cells as well as NK cells. IL12RB2 induces the promotion of T-cells towards the Th1 phenotype by strongly enhancing IFN-gamma production.

Ссылки
  • Yamamoto K, et al. (1997) Assignment of IL12RB1 and IL12RB2, interleukin-12 receptor beta 1 and beta 2 chains, to human chromosome 19 band p13.1 and chromosome 1 band p31.2, respectively, by in situ hybridization. Cytogenet. 77 (3-4): 257-8.
  • Morton SM, et al. (1998) Assignment of IL12RB2 to human chromosome 1p31.3→p31.2 between D1S230 and D1S198. Cytogenet. Cell Genet. 79 (3-4): 282-3.
  • Strausberg RL, et al. (2003) Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. Proc Natl Acad Sci USA. 99 (26): 16899-903.
  • Size / Price
    Каталог: HG10145-NM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».