After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек IkB alpha/NFKBIA Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human NFKBIA Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_020529
Размер кДНК:954bp
Описание кДНК:Full length Clone DNA of Homo sapiens nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha with C terminal His tag.
Синоним гена:IKBA, MAD-3, IkappaBalpha
Виды:Human
переносчик:pCMV3-C-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Человек IkB alpha/NFKBIA Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Человек IkB alpha/NFKBIA Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG12045-ACGRBS15400
Человек IkB alpha/NFKBIA Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG12045-ACRRBS15400
Человек IkB alpha/NFKBIA Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG12045-ANGRBS15400
Человек IkB alpha/NFKBIA Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG12045-ANRRBS15400
Человек IkB alpha/NFKBIA Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG12045-CFRBS13340
Человек IkB alpha/NFKBIA Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG12045-CHRBS13340
Человек IkB alpha/NFKBIA Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG12045-CMRBS13340
Человек IkB alpha/NFKBIA Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG12045-CYRBS13340
Человек IkB alpha/NFKBIA Джин клон кДНК в вектор клонированияHG12045-GRBS5130
Человек IkB alpha/NFKBIA Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG12045-NFRBS13340
Человек IkB alpha/NFKBIA Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG12045-NHRBS13340
Человек IkB alpha/NFKBIA Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG12045-NMRBS13340
Человек IkB alpha/NFKBIA Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG12045-NYRBS13340
Человек IkB alpha/NFKBIA Джин ORF экспрессии кДНК клона плазмидыHG12045-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha (IkB alpha, NFKBIA, or IKBA), is a member of the NF-kappa-B inhibitor family that function to inhibit the NF-kB transcription factor. NFKBIA inhibits NF-kB by masking the nuclear localization signals (NLS) of NF-kB proteins and keeping them sequestered in an inactive state in the cytoplasm. In addition, NFKBIA blocks the ability of NF-κB transcription factors to bind to DNA, which is required for NF-kB's proper functioning. Signal-induced degradation of I kappa B alpha exposes the nuclear localization signal of NF-kappa B, thus allowing it to translocate into the nucleus and activate transcription from responsive genes. An autoregulatory loop is established when NF-kappa B induces expression of the I kappa B alpha gene and newly synthesized I kappa B alpha accumulates in the nucleus where it negatively regulates NF-kappa B-dependent transcription. As part of this post-induction repression, the nuclear export signal on I kappa B alpha mediates transport of NF-kappa B-I kappa B alpha complexes from the nucleus to the cytoplasm. Deletion of NFKBIA has an effect that is similar to the effect of EGFR amplification in the pathogenesis of glioblastoma and is associated with comparatively short survival. Polymorphisms in NFKBIA may be important in pre-disposition to and outcome after treatment, of multiple myeloma (MM). The NFKBIA gene product, IkappaBalpha, binds to NF-kappaB preventing its activation and is important in mediating resistance to apoptosis in B-cell lymphoproliferative diseases.

Ссылки
  • Verma IM, et al. (1995) Rel/NF-kappa B/I kappa B family: intimate tales of association and dissociation. Genes Dev. 9 (22): 2723-35.
  • Jacobs MD, et al. (1998) Structure of an IkappaBalpha/NF-kappaB complex. Cell 95 (6): 749-58.
  • Hay RT, et al. (1999) Control of NF-kappa B transcriptional activation by signal induced proteolysis of I kappa B alpha. Philos Trans R Soc Lond B Biol Sci. 354(1389): 1601-9.
  • Spink CF, et al. (2007) Haplotypic structure across the I kappa B alpha gene (NFKBIA) and association with multiple myeloma. Cancer Lett. 246(1-2): 92-9.
  • Bredel M, et al. (2011) NFKBIA deletion in glioblastomas. N Engl J Med. 364(7): 627-37.
  • Size / Price
    Каталог: HG12045-CH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».