IGSF8 cDNA ORF Clone, Human, N-HA tag

Price:
Size:
Number:

IGSF8 cDNA ORF Clone, Human, N-HA tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1842 bp
Description
Full length Clone DNA of Human immunoglobulin superfamily, member 8 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

IGSF8 cDNA ORF Clone, Human, N-HA tag: Alternative Names

CD316 cDNA ORF Clone, Human; CD81P3 cDNA ORF Clone, Human; EWI-2 cDNA ORF Clone, Human; EWI2 cDNA ORF Clone, Human; KCT-4 cDNA ORF Clone, Human; LIR-D1 cDNA ORF Clone, Human; PGRL cDNA ORF Clone, Human

IGSF8 Background Information

Full Name
immunoglobulin superfamily, member 8
References
  • Glazar AI, et al. (2009) Immunoglobulin superfamily member IgSF8 (EWI-2) and CD9 in fertilisation: evidence of distinct functions for CD9 and a CD9-associated protein in mammalian sperm-egg interaction. Reprod Fertil Dev. 21(2): 293-303.
  • Murdoch JN, et al. (2003) Genomic organization and embryonic expression of Igsf8, an immunoglobulin superfamily member implicated in development of the nervous system and organ epithelia. Mol Cell Neurosci. 22(1): 62-74.
  • Zhang XA, et al. (2003) EWI2/PGRL associates with the metastasis suppressor KAI1/CD82 and inhibits the migration of prostate cancer cells. Cancer Res. 63 (10): 2665-74.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait