Быстрый заказ

Text Size:AAA

Человек IGSF8 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human IGSF8 Информация о продукте «Клон cDNA»
Размер кДНК:1842bp
Описание кДНК:Full length Clone DNA of Homo sapiens immunoglobulin superfamily, member 8 with N terminal HA tag.
Синоним гена:EWI2, PGRL, CD316, EWI-2, KCT-4, CD81P3, LIR-D1, IGSF8
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Человек IGSF8 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
Человек IGSF8 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13435-ACGRBS16760
Человек IGSF8 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13435-ACRRBS16760
Человек IGSF8 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13435-CFRBS14710
Человек IGSF8 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13435-CHRBS14710
Человек IGSF8 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13435-CMRBS14710
Человек IGSF8 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13435-CYRBS14710
Человек IGSF8 Джин клон кДНК в вектор клонированияHG13435-GRBS5130
Человек IGSF8 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13435-NFRBS14710
Человек IGSF8 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13435-NHRBS14710
Человек IGSF8 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13435-NMRBS14710
Человек IGSF8 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13435-NYRBS14710
Человек IGSF8 Джин ORF экспрессии кДНК клона плазмидыHG13435-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
  • Glazar AI, et al. (2009) Immunoglobulin superfamily member IgSF8 (EWI-2) and CD9 in fertilisation: evidence of distinct functions for CD9 and a CD9-associated protein in mammalian sperm-egg interaction. Reprod Fertil Dev. 21(2): 293-303.
  • Murdoch JN, et al. (2003) Genomic organization and embryonic expression of Igsf8, an immunoglobulin superfamily member implicated in development of the nervous system and organ epithelia. Mol Cell Neurosci. 22(1): 62-74.
  • Zhang XA, et al. (2003) EWI2/PGRL associates with the metastasis suppressor KAI1/CD82 and inhibits the migration of prostate cancer cells. Cancer Res. 63 (10): 2665-74.
  • Size / Price
    Каталог: HG13435-NY
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.