Быстрый заказ

Человек IGSF5 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Человек IGSF5 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001080444.1
Размер кДНК:1224bp
Описание кДНК:Full length Clone DNA of Homo sapiens immunoglobulin superfamily, member 5 with N terminal Myc tag.
Синоним гена:GSF5, JAM4
Виды:Human
переносчик:pCMV3-SP-N-Myc
Plasmid:
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Человек IGSF5 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Человек IGSF5 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG16099-ACGRBS15400
Человек IGSF5 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG16099-ACRRBS15400
Человек IGSF5 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG16099-CFRBS13340
Человек IGSF5 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG16099-CHRBS13340
Человек IGSF5 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG16099-CMRBS13340
Человек IGSF5 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG16099-CYRBS13340
Человек IGSF5 Джин клон кДНК в вектор клонированияHG16099-GRBS5130
Человек IGSF5 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG16099-NFRBS13340
Человек IGSF5 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG16099-NHRBS13340
Человек IGSF5 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG16099-NMRBS13340
Человек IGSF5 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG16099-NYRBS13340
Человек IGSF5 Джин ORF экспрессии кДНК клона плазмидыHG16099-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG16099-NM
Цена по прейскуранту: 
Цена:      (You Save: )
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».