Быстрый заказ

Человек IGFL1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human IGFL1 Информация о продукте «Клон cDNA»
Размер кДНК:333bp
Описание кДНК:Full length Clone DNA of Homo sapiens IGF-like family member 1 with N terminal Myc tag.
Синоним гена:UNQ644, APRG644
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Человек IGFL1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Человек IGFL1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG16095-ACGRBS15396
Человек IGFL1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG16095-ACRRBS15396
Человек IGFL1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG16095-CFRBS13343
Человек IGFL1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG16095-CHRBS13343
Человек IGFL1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG16095-CMRBS13343
Человек IGFL1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG16095-CYRBS13343
Человек IGFL1 Джин клон кДНК в вектор клонированияHG16095-GRBS5132
Человек IGFL1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG16095-NFRBS13343
Человек IGFL1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG16095-NHRBS13343
Человек IGFL1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG16095-NMRBS13343
Человек IGFL1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG16095-NYRBS13343
Человек IGFL1 Джин ORF экспрессии кДНК клона плазмидыHG16095-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG16095-NM
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.