After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек IGFBP7 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human IGFBP7 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001553.1
Размер кДНК:849bp
Описание кДНК:Full length Clone DNA of Homo sapiens insulin-like growth factor binding protein 7 with N terminal Myc tag.
Синоним гена:AGM, PSF, TAF, FSTL2, IBP-7, MAC25, IGFBP-7, IGFBP-7v, IGFBPRP1, IGFBP7
Виды:Human
переносчик:pCMV3-SP-N-Myc
Plasmid:
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Человек IGFBP7 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Человек IGFBP7 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13100-ACGRBS15400
Человек IGFBP7 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13100-ACRRBS15400
Человек IGFBP7 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13100-CFRBS13340
Человек IGFBP7 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13100-CHRBS13340
Человек IGFBP7 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13100-CMRBS13340
Человек IGFBP7 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13100-CYRBS13340
Человек IGFBP7 Джин клон кДНК в вектор клонированияHG13100-GRBS5130
Человек IGFBP7 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13100-NFRBS13340
Человек IGFBP7 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13100-NHRBS13340
Человек IGFBP7 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13100-NMRBS13340
Человек IGFBP7 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13100-NYRBS13340
Человек IGFBP7 Джин ORF экспрессии кДНК клона плазмидыHG13100-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Insulin like growth factor binding protein 7 (IGFBP7) is a member of the IGFBP family. It has been identified in colorectal adenocarcinoma (CRC) cell lines. The Insulin-like growth factor-binding protein also known as IGFBP serves as a carrier protein for Insulin-like growth factor 1. IGFBPs are clearly distinct but are sharing regions with strong homology. All members of the IGFBP family bind IGF-I and IGF-II with about equal affinity. Insulin-like growth factor (IGF) binding proteins (IGFBPs) have been shown to either inhibit or enhance the action of IGF, or act in an IGF-independent manner in the prostate. IGFBP7 could inhibit cell growth, decrease soft agar colony formation activity and induce apoptosis in RKO and SW620 cells. There is mounting evidence that the structure of the IGFBP proteins plays a key role in the regulation of IGF bioavailability, by modulating its molecular size, capillary membrane permeability, target tissue specificity, cell membrane adherence and IGF affinity.

Ссылки
  • Oh Y, et al. (1996) Synthesis and characterization of insulin-like growth factor-binding protein (IGFBP)-7. Recombinant human mac25 protein specifically binds IGF-I and -II. J Biol Chem. 271(48): 30322-5.
  • Wilson EM, et al. (1997) Generation and characterization of an IGFBP-7 antibody: identification of 31kD IGFBP-7 in human biological fluids and Hs578T human breast cancer conditioned media. J Clin Endocrinol Metab. 82(4): 1301-3.
  • Lin J, et al. (2007) Methylation patterns of IGFBP7 in colon cancer cell lines are associated with levels of gene expression. J Pathol. 212(1): 83-90.
  • Size / Price
    Каталог: HG13100-NM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».