After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Человек IGFBP4 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human IGFBP4 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001552.2
Размер кДНК:777bp
Описание кДНК:Full length Clone DNA of Homo sapiens insulin-like growth factor binding protein 4 with C terminal Flag tag.
Синоним гена:BP-4, IBP4, IGFBP-4, HT29-IGFBP
Виды:Human
переносчик:pCMV3-C-FLAG
Plasmid:
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Человек IGFBP4 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
Человек IGFBP4 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10967-ACGRBS15400
Человек IGFBP4 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10967-ACRRBS15400
Человек IGFBP4 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10967-CFRBS13340
Человек IGFBP4 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10967-CHRBS13340
Человек IGFBP4 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10967-CMRBS13340
Человек IGFBP4 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10967-CYRBS13340
Человек IGFBP4 Джин клон кДНК в вектор клонированияHG10967-MRBS5130
Человек IGFBP4 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10967-NFRBS13340
Человек IGFBP4 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10967-NHRBS13340
Человек IGFBP4 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10967-NMRBS13340
Человек IGFBP4 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10967-NYRBS13340
Человек IGFBP4 Джин ORF экспрессии кДНК клона плазмидыHG10967-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Insulin-like growth factor binding protein 4 (IGFBP-4) is a 24-kDa protein that binds insulin-like growth factor 1 (IGF-1) and IGF-2 with high affinity and inhibits IGF action in vitro. The Insulin-like growth factor-binding protein also known as IGFBP serves as a carrier protein for Insulin-like growth factor 1. IGFBPs are clearly distinct but are sharing regions with strong homology. All members of the IGFBP family bind IGF-I and IGF-II with about equal affinity. Insulin-like growth factor (IGF) binding proteins (IGFBPs) have been shown to either inhibit or enhance the action of IGF, or act in an IGF-independent manner in the prostate. IGF-binding protein-4 (IGFBP-4) inhibits IGF-I action in vitro and is the most abundant IGFBP in the rodent arterial wall. Expression of IGFBP-4 mRNA in nontransgenic littermates was maximal in liver and kidney. IGFBP-4 is a functional antagonist of IGF-I action on SMC. There is mounting evidence that the structure of the IGFBP proteins plays a key role in the regulation of IGF bioavailability, by modulating its molecular size, capillary membrane permeability, target tissue specificity, cell membrane adherence and IGF affinity.

Ссылки
  • Wang J, et al. (1998) Overexpression of insulin-like growth factor-binding protein-4 (IGFBP-4) in smooth muscle cells of transgenic mice through a smooth muscle alpha-actin-IGFBP-4 fusion gene induces smooth muscle hypoplasia. Endocrinology. 139(5): 2605-14.
  • Chernausek SD, et al. (1995) Proteolytic cleavage of insulin-like growth factor binding protein 4 (IGFBP-4). Localization of cleavage site to non-homologous region of native IGFBP-4. J Biol Chem. 1995 May 12;270(19):11377-82.
  • Size / Price
    Каталог: HG10967-CF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».