Быстрый заказ

Человек IGF2BP2/IMP2 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек IGF2BP2 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_006548.4
    Размер кДНК:1800bp
    Описание кДНК:Full length Clone DNA of Homo sapiens insulin-like growth factor 2 mRNA binding protein 2 with C terminal His tag.
    Синоним гена:p62, IMP2, IMP-2, VICKZ2
    Виды:Human
    переносчик:pCMV3-C-His
    Plasmid:
    Участок рестрикции:
    Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with IGF2BP2 qPCR primers for gene expression analysis, HP101030 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

    Человек IGF2BP2/IMP2 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
    Человек IGF2BP2/IMP2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG11116-ACGRBS16760
    Человек IGF2BP2/IMP2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG11116-ACRRBS16760
    Человек IGF2BP2/IMP2 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG11116-ANGRBS16760
    Человек IGF2BP2/IMP2 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG11116-ANRRBS16760
    Человек IGF2BP2/IMP2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11116-CFRBS14710
    Человек IGF2BP2/IMP2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG11116-CHRBS14710
    Человек IGF2BP2/IMP2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG11116-CMRBS14710
    Человек IGF2BP2/IMP2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG11116-CYRBS14710
    Человек IGF2BP2/IMP2 Джин клон кДНК в вектор клонированияHG11116-MRBS5130
    Человек IGF2BP2/IMP2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11116-M-FRBS14710
    Человек IGF2BP2/IMP2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG11116-NFRBS14710
    Человек IGF2BP2/IMP2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG11116-NHRBS14710
    Человек IGF2BP2/IMP2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG11116-NMRBS14710
    Человек IGF2BP2/IMP2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG11116-NYRBS14710
    Человек IGF2BP2/IMP2 Джин ORF экспрессии кДНК клона плазмидыHG11116-UTRBS14710
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Фон

    Insulin-like growth factor 2 mRNA-binding protein 2 (IGF2BP2) is a member of the IGF-II mRNA-binding protein (IMP) family. IGF2BP2 is a member of a family of mRNA binding proteins that, collectively, have been shown to bind to several different mRNAs in mammalian cells, including one of the mRNAs encoding insulin-like growth factor-2. Insulin-like growth factor 2 mRNA-binding protein 2 (IGF2BP2) is involved in the stimulation of insulin action. IGF2BP2 / IMP2 is expressed in oocytes, granulosa cells of small and growing follicles, Leydig cells, spermatogonia and semen (at protein level). It is also expressed in testicular cancer (at protein level). It is expressed weakly in heart, placenta, skeletal muscle, bone marrow, colon, kidney, salivary glands, testis and pancreas. IGF2BP2 binds to the 5'-UTR of the insulin-like growth factor 2 (IGF2) mRNAs. This binding is isoform-specific. IGF2BP2 may regulate translation of target mRNAs.

    Ссылки
  • Omori S, et al. (2008) Association of CDKAL1, IGF2BP2, CDKN2A/B, HHEX, SLC30A8, and KCNJ11 with susceptibility to type 2 diabetes in a Japanese population. Diabetes. 57(3): 791-5.
  • Grarup N, et al. (2007) Studies of association of variants near the HHEX, CDKN2A/B, and IGF2BP2 genes with type 2 diabetes and impaired insulin release in 10,705 Danish subjects: validation and extension of genome-wide association studies. Diabetes. 56(12): 3105-11.
  • Wu Y, et al. (2008) Common variants in CDKAL1, CDKN2A/B, IGF2BP2, SLC30A8, and HHEX/IDE genes are associated with type 2 diabetes and impaired fasting glucose in a Chinese Han population. Diabetes. 57(10): 2834-42.
  • Size / Price
    Каталог: HG11116-CH
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».