After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек IFN omega Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human IFNW1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_002177.1
Размер кДНК:588bp
Описание кДНК:Full length Clone DNA of Homo sapiens interferon, omega 1 with C terminal Flag tag.
Синоним гена:IFNW1
Виды:Human
переносчик:pCMV3-C-FLAG
Plasmid:
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Человек IFN omega Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
Человек IFN omega Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10353-ACGRBS15400
Человек IFN omega Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10353-ACRRBS15400
Человек IFN omega Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10353-CFRBS13340
Человек IFN omega Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10353-CHRBS13340
Человек IFN omega Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10353-CMRBS13340
Человек IFN omega Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10353-CYRBS13340
Человек IFN omega Джин клон кДНК в вектор клонированияHG10353-MRBS5130
Человек IFN omega Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10353-M-FRBS13340
Человек IFN omega Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10353-NFRBS13340
Человек IFN omega Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10353-NHRBS13340
Человек IFN omega Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10353-NMRBS13340
Человек IFN omega Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10353-NYRBS13340
Человек IFN omega Джин ORF экспрессии кДНК клона плазмидыHG10353-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

IFNs are a large family of proteins having antiviral, antiproliferative, and immunomodulatory effects, and are divided into two major classes, type I  and type I I, on the basis of differences in receptor binding and nucleotide sequence. Type I IFNs consist of IFN α, β, τ, and ω and bind to the type I  IFN receptor, whereas IFN-γ is the only type I I IFN and is specific for the type I I IFN receptor. Human IFN-ω, was identified by three independent groups in 1985 and is structurally related to IFN-α and -β. Both human IFN-ω and IFN-α are produced by virally induced leukocytes and have similar antiviral activities on human cell lines, and a sizeable proportion (at least 10%) of the total antiviral activity of leukocyte IFN is contributed by IFN-ωl. In addition, it was reported that IFN-ω could inhibit the growth of human tumors in vivo.

Size / Price
Каталог: HG10353-CF
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».