Быстрый заказ

Человек Interferon alpha-B / IFNA8 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human IFNA8 Информация о продукте «Клон cDNA»
Размер кДНК:570bp
Описание кДНК:Full length Clone DNA of Homo sapiens interferon, alpha 8 with C terminal Flag tag.
Синоним гена:IFNA8
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Человек Interferon alpha-B / IFNA8 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
Человек Interferon alpha-B / IFNA8 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10347-ACGRBS15400
Человек Interferon alpha-B / IFNA8 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10347-ACRRBS15400
Человек Interferon alpha-B / IFNA8 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10347-CFRBS13340
Человек Interferon alpha-B / IFNA8 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10347-CHRBS13340
Человек Interferon alpha-B / IFNA8 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10347-CMRBS13340
Человек Interferon alpha-B / IFNA8 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10347-CYRBS13340
Человек Interferon alpha-B / IFNA8 Джин клон кДНК в вектор клонированияHG10347-MRBS5130
Человек Interferon alpha-B / IFNA8 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10347-M-FRBS13340
Человек Interferon alpha-B / IFNA8 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10347-NFRBS13340
Человек Interferon alpha-B / IFNA8 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10347-NHRBS13340
Человек Interferon alpha-B / IFNA8 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10347-NMRBS13340
Человек Interferon alpha-B / IFNA8 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10347-NYRBS13340
Человек Interferon alpha-B / IFNA8 Джин ORF экспрессии кДНК клона плазмидыHG10347-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Interferon alpha-B, also known as IFNA8, belongs to the alpha/beta interferon family. Interferons are proteins made and released by host cells in response to the presence of pathogens such as viruses, bacteria, parasites or tumorcells. Interferon stimulates the production of two enzymes: a protein kinase and an oligoadenylate synthetase. They also allow for communication between cells to trigger the protective defenses of the immune system that eradicate pathogens or tumors. Interferons also activate immune cells, such as natural killer cells and macrophages. They increase recognition of infection or tumor cells by up-regulating antigen presentation to T lymphocytes. They also increase the ability of uninfected host cells to resist new infection by virus. Certain symptoms, such as aching muscles and fever, are related to the production of IFNs during infection. Produced by macrophages, IFN-alpha have antiviral activities.

  • Henco K. et al., 1985, J Mol Biol. 185 (2): 227-60.
  • Goeddel DV. et al., 1981, Nature. 290 (5801): 20-6.
  • Yelverton E. et al., 1981, Nucleic Acids Res. 9 (3): 731-41.
  • Kempaiah P. et al., 2012, Hum Genet. 131 (8): 1375-91.
  • Size / Price
    Каталог: HG10347-CF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.