After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек IFNA10 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human IFNA10 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_002171.1
Размер кДНК:570bp
Описание кДНК:Full length Clone DNA of Homo sapiens interferon, alpha 10 with C terminal Flag tag.
Синоним гена:MGC119878, MGC119879
Виды:Human
переносчик:pCMV3-C-FLAG
Plasmid:
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Человек IFNA10 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
Человек IFNA10 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10349-ACGRBS15400
Человек IFNA10 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10349-ACRRBS15400
Человек IFNA10 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10349-CFRBS13340
Человек IFNA10 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10349-CHRBS13340
Человек IFNA10 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10349-CMRBS13340
Человек IFNA10 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10349-CYRBS13340
Человек IFNA10 Джин клон кДНК в вектор клонированияHG10349-MRBS5130
Человек IFNA10 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10349-M-FRBS13340
Человек IFNA10 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10349-NFRBS13340
Человек IFNA10 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10349-NHRBS13340
Человек IFNA10 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10349-NMRBS13340
Человек IFNA10 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10349-NYRBS13340
Человек IFNA10 Джин ORF экспрессии кДНК клона плазмидыHG10349-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Interferon alpha-10 (IFNA10) is a member of the interferon family. Interferons belong to the group of the regulatory glycoproteins, of low molecular mass. They are the products of infected cell-genome, but not virus, as a consequence of the cause answer by different inductors. Interferon stimulates the production of two enzymes: a protein kinase and an oligoadenylate synthetase. They allow communication between cells to trigger the protective defenses of the immune system that eradicate pathogens or tumors. IFNs have other functions: they activate immune cells, such as natural killer cells and macrophages; they increase recognition of infection or tumor cells by up-regulating antigen presentation to T lymphocytes; and they increase the ability of uninfected host cells to resist new infection by virus. Certain host symptoms, such as aching muscles and fever, are related to the production of IFNs during infection. Human IFN are divided on the sequence of amino-acids into three groups: Alpha, Beta and Gamma interferons.

Ссылки
  • De Veer MJ, et al. (2001) Functional classification of interferon-stimulated genes identified using microarrays. J Leukoc Biol. 69 (6): 912-20.
  • Liu YJ. (2005) IPC: professional type 1 interferon-producing cells and plasmacytoid dendritic cell precursors. Annu Rev Immunol. 23: 275-306.
  • Fensterl V, et al. (2009) Interferons and viral infections. Biofactors. 35 (1): 14-20.
  •  

    IFNA10 related areas, pathways, and other information

    Size / Price
    Каталог: HG10349-CF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».