After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек IFN-alpha / IFNA1 / IFN Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human IFNA1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC112300
Размер кДНК:570bp
Описание кДНК:Full length Clone DNA of Homo sapiens interferon, alpha 1 with N terminal His tag.
Синоним гена:IFL, IFN, IFNA@, IFNA13, IFN-ALPHA, IFN-alphaD
Виды:Human
переносчик:pCMV3-SP-N-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Человек IFN-alpha / IFNA1 / IFN Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Человек IFN-alpha / IFNA1 / IFN Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG12341-ACGRBS15400
Человек IFN-alpha / IFNA1 / IFN Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG12341-ACRRBS15400
Человек IFN-alpha / IFNA1 / IFN Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG12341-CFRBS13340
Человек IFN-alpha / IFNA1 / IFN Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG12341-CHRBS13340
Человек IFN-alpha / IFNA1 / IFN Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG12341-CMRBS13340
Человек IFN-alpha / IFNA1 / IFN Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG12341-CYRBS13340
Человек IFN-alpha / IFNA1 / IFN Джин клон кДНК в вектор клонированияHG12341-GRBS5130
Человек IFN-alpha / IFNA1 / IFN Джин ORF экспрессии кДНК клона плазмидыHG12341-G-NRBS13340
Человек IFN-alpha / IFNA1 / IFN Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG12341-NFRBS13340
Человек IFN-alpha / IFNA1 / IFN Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG12341-NHRBS13340
Человек IFN-alpha / IFNA1 / IFN Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG12341-NMRBS13340
Человек IFN-alpha / IFNA1 / IFN Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG12341-NYRBS13340
Человек IFN-alpha / IFNA1 / IFN Джин ORF экспрессии кДНК клона плазмидыHG12341-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

IFNA1, also known as IFN-alpha and IFNA, belongs to the alpha/beta interferon family. Interferons(IFNs) are proteins made and released by host cells in response to the presence of pathogens such as viruses, bacteria, parasites or tumor cells. They belong to the large class of glycoproteins known as cytokines. IFNs stimulate the production of two enzymes: a protein kinase and an oligoadenylate synthetase. They allow for communication between cells to trigger the protective defenses of the immune system that eradicate pathogens or tumors. IFNs can activate immune cells, such as natural killer cells and macrophages; they increase recognition of infection or tumor cells by up-regulating antigen presentation to T lymphocytes; and they also increase the ability of uninfected host cells to resist new infection by virus.Leukocyte interferon is produced predominantly by B lymphocytes. Immune interferon is produced by mitogen- or antigen-stimulated T lymphocytes. IFNA1 is produced by macrophages and has antiviral activities.

Ссылки
  • Takayama I, et al. (2012) The nucleocapsid protein of measles virus blocks host interferon response. Virology. 424(1):45-55.
  • Vairo D, et al. (2011) Severe impairment of IFN-? and IFN-? responses in cells of a patient with a novel STAT1 splicing mutation. Blood. 118(7):1806-17.
  • Bhattacharya S, et al. (2011) Bcr-abl signals to desensitize chronic myeloid leukemia cells to IFN? via accelerating the degradation of its receptor. Blood. 118(15):4179-87.
  • Size / Price
    Каталог: HG12341-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».