Быстрый заказ

Человек IFNA5/IFNaG Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human IFNA5 Информация о продукте «Клон cDNA»
Размер кДНК:570bp
Описание кДНК:Full length Clone DNA of Homo sapiens interferon, alpha 5 with C terminal Flag tag.
Синоним гена:IFNA5, RP11-380P16.5
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Человек IFNA5/IFNaG Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
Человек IFNA5/IFNaG Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10342-ACGRBS15396
Человек IFNA5/IFNaG Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10342-ACRRBS15396
Человек IFNA5/IFNaG Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10342-CFRBS13343
Человек IFNA5/IFNaG Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10342-CHRBS13343
Человек IFNA5/IFNaG Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10342-CMRBS13343
Человек IFNA5/IFNaG Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10342-CYRBS13343
Человек IFNA5/IFNaG Джин клон кДНК в вектор клонированияHG10342-MRBS5132
Человек IFNA5/IFNaG Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10342-M-FRBS13343
Человек IFNA5/IFNaG Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10342-NFRBS13343
Человек IFNA5/IFNaG Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10342-NHRBS13343
Человек IFNA5/IFNaG Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10342-NMRBS13343
Человек IFNA5/IFNaG Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10342-NYRBS13343
Человек IFNA5/IFNaG Джин ORF экспрессии кДНК клона плазмидыHG10342-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Interferon, alpha 5 (IFNA5) belongs to the alpha/beta interferon family. IFNA5 is the only IFNA subtype detected in normal liver, while a mixture of subtypes is observed in the liver tissue of patients with chronic hepatitis C. Interferons are produced by macrophages, IFN-alpha have antiviral activities. Interferon stimulates the production of two enzymes: a protein kinase and an oligoadenylate synthetase. IFN-alpha, the first cytokine to be produced by recombinant DNA technology, has emerged as an important regulator of growth and differentiation, affecting cellular communication and signal transduction pathways as well as immunological control. Originally discovered as an antiviral substance, the efficacy of IFN-alpha in malignant, viral, immunological, angiogenic, inflammatory, and fibrotic diseases suggests a spectrum of interrelated pathophysiologies. IFN-alpha emerged as a prototypic tumor suppressor protein that represses the clinical tumorigenic phenotype in some malignancies capable of differentiation.

  • Lau JY, et al. (1993) Discrepancy between biochemical and virological responses to interferon-alpha in chronic hepatitis C. Lancet. 342(8881): 1208-9.
  • Kessler DS, et al. (1990) Interferon-alpha regulates nuclear translocation and DNA-binding affinity of ISGF3, a multimeric transcriptional activator. Genes Dev. 4(10): 1753-65.
  • Gutterman JU. Cytokine therapeutics: lessons from interferon alpha. Proc Natl Acad Sci U S A. 91(4): 1198-205.
  • Size / Price
    Каталог: HG10342-CF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.