Быстрый заказ

Человек IFNA5/IFNaG Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек IFNA5 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_002169.1
    Размер кДНК:570bp
    Описание кДНК:Full length Clone DNA of Homo sapiens interferon, alpha 5 with C terminal Flag tag.
    Синоним гена:IFNA5, RP11-380P16.5
    Виды:Human
    переносчик:pCMV3-C-FLAG
    Plasmid:
    Участок рестрикции:
    Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with IFNA5 qPCR primers for gene expression analysis, HP100380 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    FLAG Tag Info

    FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

    The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

    Человек IFNA5/IFNaG Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
    Человек IFNA5/IFNaG Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10342-ACGRBS15400
    Человек IFNA5/IFNaG Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10342-ACRRBS15400
    Человек IFNA5/IFNaG Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10342-CFRBS13340
    Человек IFNA5/IFNaG Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10342-CHRBS13340
    Человек IFNA5/IFNaG Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10342-CMRBS13340
    Человек IFNA5/IFNaG Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10342-CYRBS13340
    Человек IFNA5/IFNaG Джин клон кДНК в вектор клонированияHG10342-MRBS5130
    Человек IFNA5/IFNaG Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10342-M-FRBS13340
    Человек IFNA5/IFNaG Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10342-NFRBS13340
    Человек IFNA5/IFNaG Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10342-NHRBS13340
    Человек IFNA5/IFNaG Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10342-NMRBS13340
    Человек IFNA5/IFNaG Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10342-NYRBS13340
    Человек IFNA5/IFNaG Джин ORF экспрессии кДНК клона плазмидыHG10342-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Фон

    Interferon, alpha 5 (IFNA5) belongs to the alpha/beta interferon family. IFNA5 is the only IFNA subtype detected in normal liver, while a mixture of subtypes is observed in the liver tissue of patients with chronic hepatitis C. Interferons are produced by macrophages, IFN-alpha have antiviral activities. Interferon stimulates the production of two enzymes: a protein kinase and an oligoadenylate synthetase. IFN-alpha, the first cytokine to be produced by recombinant DNA technology, has emerged as an important regulator of growth and differentiation, affecting cellular communication and signal transduction pathways as well as immunological control. Originally discovered as an antiviral substance, the efficacy of IFN-alpha in malignant, viral, immunological, angiogenic, inflammatory, and fibrotic diseases suggests a spectrum of interrelated pathophysiologies. IFN-alpha emerged as a prototypic tumor suppressor protein that represses the clinical tumorigenic phenotype in some malignancies capable of differentiation.

    Ссылки
  • Lau JY, et al. (1993) Discrepancy between biochemical and virological responses to interferon-alpha in chronic hepatitis C. Lancet. 342(8881): 1208-9.
  • Kessler DS, et al. (1990) Interferon-alpha regulates nuclear translocation and DNA-binding affinity of ISGF3, a multimeric transcriptional activator. Genes Dev. 4(10): 1753-65.
  • Gutterman JU. Cytokine therapeutics: lessons from interferon alpha. Proc Natl Acad Sci U S A. 91(4): 1198-205.
  • Size / Price
    Каталог: HG10342-CF
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».