Быстрый заказ

Человек IFNAR2/IFNABR transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Человек IFNAR2 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_207585.1
Размер кДНК:1548bp
Описание кДНК:Full length Clone DNA of Homo sapiens interferon (alpha, beta and omega) receptor 2, transcript variant 1 with C terminal Flag tag.
Синоним гена:IFN-R, IFNABR, IFNARB, IFN-alpha-REC, IFNAR2
Виды:Human
переносчик:pCMV3-C-FLAG
Plasmid:
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with IFNAR2 qPCR primers for gene expression analysis, HP100059 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Человек IFNAR2/IFNABR transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
Человек IFNAR2/IFNABR transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10359-ACGRBS16760
Человек IFNAR2/IFNABR transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10359-ACRRBS16760
Человек IFNAR2/IFNABR transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10359-CFRBS14710
Человек IFNAR2/IFNABR transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10359-CHRBS14710
Человек IFNAR2/IFNABR transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10359-CMRBS14710
Человек IFNAR2/IFNABR transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10359-CYRBS14710
Человек IFNAR2/IFNABR transcript variant 1 Джин клон кДНК в вектор клонированияHG10359-MRBS5130
Человек IFNAR2/IFNABR transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10359-NFRBS14710
Человек IFNAR2/IFNABR transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10359-NHRBS14710
Человек IFNAR2/IFNABR transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10359-NMRBS14710
Человек IFNAR2/IFNABR transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10359-NYRBS14710
Человек IFNAR2/IFNABR transcript variant 1 Джин ORF экспрессии кДНК клона плазмидыHG10359-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Interferon-alpha/beta receptor beta chain (IFNAR2) is a type I membrane protein that forms one of the two chains of a receptor for interferons alpha and beta. Binding and activation of the receptor stimulates Janus protein kinases, which in turn phosphorylate several proteins, including STAT1 and STAT2. Initial cell-surface IFNAR2 expression at diagnosis assessed by flow cytometry widely distributed but showed overall significantly higher expression in CML patients when compared with normal controls. In 15 fresh patients who subsequently received IFNα therapy, IFNAR2 expression at diagnosis was significantly higher in cytogenetic good responders than in poor responders. Down-regulation of IFNAR2 expression during IFNα therapy was observed only in good responders but not in poor responders. The encoded protein also functions as an antiviral factor. IFNAR2 may associate with IFNAR1 to form the type I interferon receptor. This protein serves as a receptor for interferons alpha and beta. IFNAR2 is also involved in IFN-mediated STAT1, STAT2 and STAT3 activation. Isoform 1 and isoform 2 are directly involved in signal transduction due to their association with the TYR kinase, JAK1. Isoform 3 is a potent inhibitor of type I IFN receptor activity. Following binding of IFNα2, IFNAR2 is internalized, but, instead of being routed towards degradation as it is when complexed to IFNβ, it recycles back to the cell surface.

Ссылки
  • Ito K, et al. (2004) Initial expression of interferon alpha receptor 2 (IFNAR2) on CD34-positive cells and its down-regulation correlate with clinical response to interferon therapy in chronic myelogenous leukemia. Eur J Haematol. 73(3): 191-205.
  • Kim SH, et al. (1997) Mammalian type I interferon receptors consists of two subunits: IFNaR1 and IFNaR2. Gene. 196(1-2): 279-86.
  • Saleh AZ, et al. (2004) Regulated proteolysis of the IFNaR2 subunit of the interferon-alpha receptor. Oncogene. 23(42): 7076-86.
  • Size / Price
    Каталог: HG10359-CF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Contact Us
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».