After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Человек MDA5/IFIH1 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human IFIH1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC046208
Размер кДНК:666bp
Описание кДНК:Full length Clone DNA of Homo sapiens interferon induced with helicase C domain 1 with N terminal His tag.
Синоним гена:Hlcd, MDA5, MDA-5, RLR-2, IDDM19
Виды:Human
переносчик:pCMV3-N-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Человек MDA5/IFIH1 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Человек MDA5/IFIH1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG15389-ACGRBS15396
Человек MDA5/IFIH1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG15389-ACRRBS15396
Человек MDA5/IFIH1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG15389-ANGRBS15396
Человек MDA5/IFIH1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG15389-ANRRBS15396
Человек MDA5/IFIH1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG15389-CFRBS13343
Человек MDA5/IFIH1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG15389-CHRBS13343
Человек MDA5/IFIH1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG15389-CMRBS13343
Человек MDA5/IFIH1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG15389-CYRBS13343
Человек MDA5/IFIH1 Джин клон кДНК в вектор клонированияHG15389-GRBS5132
Человек MDA5/IFIH1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG15389-NFRBS13343
Человек MDA5/IFIH1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG15389-NHRBS13343
Человек MDA5/IFIH1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG15389-NMRBS13343
Человек MDA5/IFIH1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG15389-NYRBS13343
Человек MDA5/IFIH1 Джин ORF экспрессии кДНК клона плазмидыHG15389-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG15389-NH
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».