After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Человек IFI30 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human IFI30 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_006332.4
Размер кДНК:753bp
Описание кДНК:Full length Clone DNA of Homo sapiens interferon, gamma-inducible protein 30 with N terminal Flag tag.
Синоним гена:GILT, IP30, IFI-30
Виды:Human
переносчик:pCMV3-SP-N-FLAG
Plasmid:
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Человек IFI30 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Человек IFI30 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG16347-ACGRBS15400
Человек IFI30 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG16347-ACRRBS15400
Человек IFI30 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG16347-CFRBS13340
Человек IFI30 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG16347-CHRBS13340
Человек IFI30 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG16347-CMRBS13340
Человек IFI30 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG16347-CYRBS13340
Человек IFI30 Джин клон кДНК в вектор клонированияHG16347-GRBS5130
Человек IFI30 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG16347-NFRBS13340
Человек IFI30 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG16347-NHRBS13340
Человек IFI30 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG16347-NMRBS13340
Человек IFI30 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG16347-NYRBS13340
Человек IFI30 Джин ORF экспрессии кДНК клона плазмидыHG16347-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

IFI30 belongs to the GILT family. This family includes the two characterised human gamma-interferon-inducible lysosomal thiol reductase (GILT) sequences: P13284 and Q9UL08. It also contains several other eukaryotic putative proteins with similarity to GILT. The aligned region contains three conserved cysteine residues. In addition, the two GILT sequences possess a C-X(2)-C motif that is shared by some of the other sequences in the family. This motif is thought to be associated with disulphide bond reduction. IFI30 is a lysosomal thiol reductase that can reduce protein disulfide bonds. It facilitates the generation of MHC class II-restricted epitodes from disulfide bond-containing antigen by the endocytic reduction of disulfide bonds. It also facilitates MHC class I-restricted recognition of exogenous antigens containing disulfide bonds by CD8+ T-cells or crosspresentation. IFI30 may facilitate the complete unfolding of proteins destined for lysosomal degradation and plays an important role in antigen processing.

Ссылки
  • Haque MA, et al. (2002) Absence of gamma-Interferon-inducible Lysosomal Thiol Reductase in Melanomas Disrupts T Cell Recognition of Select Immunodominant Epitopes. J Exp Med. 195(10):1267-77.
  • Phan UT, et al. (2000) Gamma-interferon-inducible lysosomal thiol reductase (GILT). Maturation, activity, and mechanism of action. J Biol Chem. 275(34):25907-14.
  • Phan UT, et al. (2001) Multiple species express thiol oxidoreductases related to GILT. Immunogenetics. 53(4):342-6.
  • Size / Price
    Каталог: HG16347-NF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».