After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек Iduronate 2-Sulfatase / IDS transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human IDS Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_000202.5
Размер кДНК:1653bp
Описание кДНК:Full length Clone DNA of Homo sapiens iduronate 2-sulfatase, transcript variant 1 with C terminal Flag tag.
Синоним гена:MPS2, SIDS
Виды:Human
переносчик:pCMV3-C-FLAG
Plasmid:pCMV3-IDS-Flag
Участок рестрикции:KpnI + XbaI (6kb + 1.69kb)
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Human IDS Gene Plasmid Map
Human IDS / MPS2 transcript variant 1 natural ORF mammalian expression plasmid, C-Flag tag
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Человек Iduronate 2-Sulfatase / IDS transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
Человек Iduronate 2-Sulfatase / IDS transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10337-ACGRBS16764
Человек Iduronate 2-Sulfatase / IDS transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10337-ACRRBS16764
Человек Iduronate 2-Sulfatase / IDS transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10337-CFRBS14711
Человек Iduronate 2-Sulfatase / IDS transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10337-CHRBS14711
Человек Iduronate 2-Sulfatase / IDS transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10337-CMRBS14711
Человек Iduronate 2-Sulfatase / IDS transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10337-CYRBS14711
Человек Iduronate 2-Sulfatase / IDS transcript variant 1 Джин клон кДНК в вектор клонированияHG10337-MRBS5132
Человек Iduronate 2-Sulfatase / IDS transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10337-NFRBS14711
Человек Iduronate 2-Sulfatase / IDS transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10337-NHRBS14711
Человек Iduronate 2-Sulfatase / IDS transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10337-NMRBS14711
Человек Iduronate 2-Sulfatase / IDS transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10337-NYRBS14711
Человек Iduronate 2-Sulfatase / IDS transcript variant 1 Джин ORF экспрессии кДНК клона плазмидыHG10337-UTRBS14711
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Iduronate 2-Sulfatase, also known as IDS, is a member of the highly conserved sulfatase family of enzymes that catalyze the hydrolysis of O- and N-sulfate esters from a variety of substrates. The human Iduronate 2-Sulfatase/IDS consists of a signal peptide, a pro peptide and a mature chain that may be further processed into two chains. Among the identified 18 human sulfatases, Iduronate 2-Sulfatase/IDS is required for the lysosomal degradation of the glycosaminoglycans (GAG), heparan sulfate and dermatan sulfate. Multiple mutations in this X-chromosome localized gene result in Iduronate 2-Sulfatase/IDS enzymatic deficiency, and lead to the sex-linked Mucopolysaccharidosis Type II (MPS II ), also known as Hunter Syndrome characterized by the lysosomal accumulation of the GAG and their excretion in urine. MPS II has a wide spectrum of clinical manifestations ranging from mild to severe due to the level of Iduronate 2-Sulfatase/IDS enzyme. Retroviral-mediated Iduronate 2-Sulfatase/IDS gene transfer into lymphoid cells would be a promising gene therapeutic strategy.

Size / Price
Каталог: HG10337-CF
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
НаличиеIn Stock
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
  • Human IDS / MPS2 transcript variant 1 natural ORF mammalian expression plasmid, C-Flag tag
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».