IDO cDNA ORF Clone, Human, N-HA tag

Cat: HG11650-NY

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All IDO Reagents

CRO Services

Product recommended


All IDO Reagents

IDO cDNA ORF Clone, Human, N-HA tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
1254 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human indoleamine 2,3-dioxygenase 1 with N terminal HA tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Restriction Sites
KpnI + XbaI(6kb+1.25kb)
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

IDO cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

IDO cDNA ORF Clone, Human, N-HA tag Validated Images

Cynomolgus LOC101926731 Gene Plasmid Map 5628

IDO cDNA ORF Clone, Human, N-HA tag Alternative Names

IDO cDNA ORF Clone, Human;IDO-1 cDNA ORF Clone, Human;INDO cDNA ORF Clone, Human;Indoleamine 2,3‑dioxygenase cDNA ORF Clone, Human

IDO Background Information

Indoleamine 2,3-dioxygenase-1, also known as Indoleamine-pyrrole 2,3-dioxygenase, IDO1 and IDO, is a member of the indoleamine 2,3-dioxygenase family. IDO1 / IDO and tryptophan 2,3-dioxygenase (TDO) are tryptophan-degrading enzymes that catalyze the first step in tryptophan catabolism via the kynurenine pathway. TDO is widely distributed in both eukaryotes and bacteria. In contrast, IDO has been found only in mammals and yeast. In 27, a third enzyme, indoleamine 2,3-dioxygenase-2 (IDO2), was discovered. IDO2 is found not only in mammals but also in lower vertebrates. IDO1 / IDO is an immunosuppressive molecule inducible in various cells. IDO1 / IDO catalyzes the cleavage of the pyrrol ring of tryptophan and incorporates both atoms of a molecule of oxygen. It mediates oxidative cleavage of tryptophan, an amino acid essential for cell proliferation and survival. IDO1 / IDO inhibition is proposed to have therapeutic potential in immunodeficiency-associated abnormalities, including cancer. The IDO pathway is activated in multiple tumor types. Selective inhibition of IDO1 may represent an attractive cancer therapeutic strategy via up-regulation of cellular immunity. IDO1 / IDO is an enzyme that suppresses adaptive T-cell immunity by catabolizing tryptophan from the cellular microenvironment. Inhibition of IDO pathway might enhance the efficacy of immunotherapeutic strategies for cancer.Immune Checkpoint
Immune Checkpoint Detection: ELISA Antibodies
Co-inhibitory Immune Checkpoint Targets Immunotherapy   Cancer Immunotherapy   Targeted Therapy
Full Name
indoleamine 2,3-dioxygenase 1
References
  • Barnes NA. et al., 2009, J Immunol. 183 (9): 5768-77.
  • Yuasa HJ. et al., 2009, Comp Biochem Physiol B Biochem Mol Biol. 153 (2): 137-44.
  • L b S. et al., 2009, Cancer Immunol Immunother. 58 (1): 153-7.
  • Liu,X. et al., 2010, Blood.115 (17): 3520-30.
  • Sun,T. et al., 2010, Mol Cell Biochem. 342 (1-2): 29-34.
  • Kiank C. et al., 2010, PLoS One. 5 (7): e11825.
  • IDO cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    IDO cDNA ORF Clone, Rat, untagged RG82547-UT
    IDO Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG82547-ACGLN
    IDO cDNA ORF Clone, Rat, C-GFPSpark® tag RG82547-ACG
    IDO cDNA ORF Clone, Rat, N-GFPSpark® tag RG82547-ANG
    IDO cDNA ORF Clone, Rat, C-OFPSpark® tag RG82547-ACR
    IDO cDNA ORF Clone, Rat, N-OFPSpark® tag RG82547-ANR
    IDO cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG82547-CF
    IDO cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG82547-NF
    IDO cDNA ORF Clone, Rat, C-His tag RG82547-CH
    IDO cDNA ORF Clone, Rat, N-His tag RG82547-NH
    IDO cDNA ORF Clone, Rat, C-HA tag RG82547-CY
    IDO cDNA ORF Clone, Rat, N-HA tag RG82547-NY
    IDO cDNA ORF Clone, Rat, C-Myc tag RG82547-CM
    IDO cDNA ORF Clone, Rat, N-Myc tag RG82547-NM

    IDO cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    IDO cDNA ORF Clone, Mouse, untagged MG57213-UT
    IDO cDNA ORF Clone, Mouse, C-GFPSpark® tag MG57213-ACG
    IDO Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG57213-ACGLN
    IDO cDNA ORF Clone, Mouse, N-GFPSpark® tag MG57213-ANG
    IDO cDNA ORF Clone, Mouse, C-OFPSpark® tag MG57213-ACR
    IDO cDNA ORF Clone, Mouse, N-OFPSpark® tag MG57213-ANR
    IDO cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG57213-CF
    IDO cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG57213-NF
    IDO cDNA ORF Clone, Mouse, C-His tag MG57213-CH
    IDO cDNA ORF Clone, Mouse, N-His tag MG57213-NH
    IDO cDNA ORF Clone, Mouse, C-HA tag MG57213-CY
    IDO cDNA ORF Clone, Mouse, N-HA tag MG57213-NY
    IDO cDNA ORF Clone, Mouse, C-Myc tag MG57213-CM
    IDO cDNA ORF Clone, Mouse, N-Myc tag MG57213-NM

    IDO cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    IDO cDNA ORF Clone in Cloning Vector, Human HG11650-M
    IDO cDNA ORF Clone, Human, untagged HG11650-UT
    IDO cDNA ORF Clone, Human, C-GFPSpark® tag HG11650-ACG
    IDO Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11650-ACGLN
    IDO cDNA ORF Clone, Human, N-GFPSpark® tag HG11650-ANG
    IDO cDNA ORF Clone, Human, C-OFPSpark® tag HG11650-ACR
    IDO cDNA ORF Clone, Human, N-OFPSpark® tag HG11650-ANR
    IDO cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11650-CF
    IDO cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11650-NF
    IDO cDNA ORF Clone, Human, C-His tag HG11650-CH
    IDO cDNA ORF Clone, Human, N-His tag HG11650-NH
    IDO cDNA ORF Clone, Human, C-HA tag HG11650-CY
    IDO cDNA ORF Clone, Human, C-Myc tag HG11650-CM
    IDO cDNA ORF Clone, Human, N-Myc tag HG11650-NM
    IDO qPCR Primer Pairs, Human HP101496
    info info
    添加购物车成功! 添加购物车失败!