Быстрый заказ

Человек IDO1/Indoleamine 2,3‑dioxygenase Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human IDO1 Информация о продукте «Клон cDNA»
Размер кДНК:1212bp
Описание кДНК:Full length Clone DNA of Homo sapiens indoleamine 2,3-dioxygenase 1 with C terminal Flag tag.
Синоним гена:IDO, INDO, IDO1
Участок рестрикции:KpnI + XbaI (6kb + 1.25kb)
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Human IDO1 Gene Plasmid Map
Human IDO1 natural ORF mammalian expression plasmid, C-Flag tag
Human IDO1 Gene Expression validated Image
Human IDO1 ORF mammalian expression plasmid, C-Flag tag
[Щелкните, чтобы увеличить изображение]
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Человек IDO1/Indoleamine 2,3‑dioxygenase Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
Человек IDO1/Indoleamine 2,3‑dioxygenase Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG11650-ACGRBS15400
Человек IDO1/Indoleamine 2,3‑dioxygenase Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG11650-ACRRBS15400
Человек IDO1/Indoleamine 2,3‑dioxygenase Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG11650-ANGRBS15400
Человек IDO1/Indoleamine 2,3‑dioxygenase Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG11650-ANRRBS15400
Человек IDO1/Indoleamine 2,3‑dioxygenase Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11650-CFRBS13340
Человек IDO1/Indoleamine 2,3‑dioxygenase Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG11650-CHRBS13340
Человек IDO1/Indoleamine 2,3‑dioxygenase Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG11650-CMRBS13340
Человек IDO1/Indoleamine 2,3‑dioxygenase Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG11650-CYRBS13340
Человек IDO1/Indoleamine 2,3‑dioxygenase Джин клон кДНК в вектор клонированияHG11650-MRBS5130
Человек IDO1/Indoleamine 2,3‑dioxygenase Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG11650-NFRBS13340
Человек IDO1/Indoleamine 2,3‑dioxygenase Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG11650-NHRBS13340
Человек IDO1/Indoleamine 2,3‑dioxygenase Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG11650-NMRBS13340
Человек IDO1/Indoleamine 2,3‑dioxygenase Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG11650-NYRBS13340
Человек IDO1/Indoleamine 2,3‑dioxygenase Джин ORF экспрессии кДНК клона плазмидыHG11650-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Indoleamine 2,3-dioxygenase-1, also known as Indoleamine-pyrrole 2,3-dioxygenase, IDO1 and IDO, is a member of the indoleamine 2,3-dioxygenase family. IDO1 / IDO and tryptophan 2,3-dioxygenase (TDO) are tryptophan-degrading enzymes that catalyze the first step in tryptophan catabolism via the kynurenine pathway. TDO is widely distributed in both eukaryotes and bacteria. In contrast, IDO has been found only in mammals and yeast. In 2007, a third enzyme, indoleamine 2,3-dioxygenase-2 (IDO2), was discovered. IDO2 is found not only in mammals but also in lower vertebrates. IDO1 / IDO is an immunosuppressive molecule inducible in various cells. IDO1 / IDO catalyzes the cleavage of the pyrrol ring of tryptophan and incorporates both atoms of a molecule of oxygen. It mediates oxidative cleavage of tryptophan, an amino acid essential for cell proliferation and survival. IDO1 / IDO inhibition is proposed to have therapeutic potential in immunodeficiency-associated abnormalities, including cancer. The IDO pathway is activated in multiple tumor types. Selective inhibition of IDO1 may represent an attractive cancer therapeutic strategy via up-regulation of cellular immunity. IDO1 / IDO is an enzyme that suppresses adaptive T-cell immunity by catabolizing tryptophan from the cellular microenvironment. Inhibition of IDO pathway might enhance the efficacy of immunotherapeutic strategies for cancer.

  • Barnes NA. et al., 2009, J Immunol. 183 (9): 5768-77.
  • Yuasa HJ. et al., 2009, Comp Biochem Physiol B Biochem Mol Biol. 153 (2): 137-44.
  • L b S. et al., 2009, Cancer Immunol Immunother. 58 (1): 153-7.
  • Liu,X. et al., 2010, Blood.115 (17): 3520-30.
  • Sun,T. et al., 2010, Mol Cell Biochem. 342 (1-2): 29-34.
  • Kiank C. et al., 2010, PLoS One. 5 (7): e11825.
  • Size / Price
    Каталог: HG11650-CF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    НаличиеIn Stock
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    • Human IDO1 natural ORF mammalian expression plasmid, C-Flag tag
    • Human IDO1 ORF mammalian expression plasmid, C-Flag tag
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.