Быстрый заказ

Человек IDH1 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

  • Human IDH1 natural ORF mammalian expression plasmid, C-His tag
ПаспортОбзорыСвязанные продуктыПротоколы
Человек IDH1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_005896.2
Размер кДНК:1245bp
Описание кДНК:Full length Clone DNA of Homo sapiens isocitrate dehydrogenase 1 (NADP+), soluble with C terminal His tag.
Синоним гена:IDH, IDP, IDCD, IDPC, PICD, IDH1
Виды:Human
переносчик:pCMV3-C-His
Plasmid:pCMV3-IDH1-His
Участок рестрикции:KpnI + XbaI (6kb + 1.29kb)
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with IDH1 qPCR primers for gene expression analysis, HP100077 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек IDH1 Gene Plasmid Map
Human IDH1 natural ORF mammalian expression plasmid, C-His tag
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Человек IDH1 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Человек IDH1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG12055-ACGRBS15400
Человек IDH1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG12055-ACRRBS15400
Человек IDH1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG12055-ANGRBS15400
Человек IDH1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG12055-ANRRBS15400
Человек IDH1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG12055-CFRBS13340
Человек IDH1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG12055-CHRBS13340
Человек IDH1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG12055-CMRBS13340
Человек IDH1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG12055-CYRBS13340
Человек IDH1 Джин клон кДНК в вектор клонированияHG12055-GRBS5130
Человек IDH1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG12055-G-YRBS13340
Человек IDH1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG12055-NFRBS13340
Человек IDH1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG12055-NHRBS13340
Человек IDH1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG12055-NMRBS13340
Человек IDH1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG12055-NYRBS13340
Человек IDH1 Джин ORF экспрессии кДНК клона плазмидыHG12055-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Ссылки
  • Takano S, et al. (2011) Detection of IDH1 mutation in human gliomas: comparison of immunohistochemistry and sequencing. Brain Tumor Pathol. 28(2): 115-23.
  • Geisbrecht BV, et al. (1999) The human PICD gene encodes a cytoplasmic and peroxisomal NADP(+)-dependent isocitrate dehydrogenase. J Biol Chem. 274(43): 30527-30533.
  • Nekrutenko A, et al. (1998) Cytosolic isocitrate dehydrogenase in humans, mice, and voles and phylogenetic analysis of the enzyme family. Mol Biol Evol. 15(12): 1674-1684.
  • Henke B, et al. (1998) IDP3 encodes a peroxisomal NADP-dependent isocitrate dehydrogenase required for the beta-oxidation of unsaturated fatty acids. J Biol Chem. 273(6): 3702-3711.
  • Gabriel JL, et al. (1986) Activity of purified NAD-specific isocitrate dehydrogenase at modulator and substrate concentrations approximating conditions in mitochondria. Metabolism. 35(7): 661-667.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».