After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек Insulysin/insulin-degrading enzyme Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human IDE Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC096336
Размер кДНК:3060bp
Описание кДНК:Full length Clone DNA of Homo sapiens insulin-degrading enzyme with N terminal His tag.
Синоним гена:INSULYSIN
Виды:Human
переносчик:pCMV3-SP-N-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Человек Insulysin/insulin-degrading enzyme Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Человек Insulysin/insulin-degrading enzyme Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG15978-ACGRBS22240
Человек Insulysin/insulin-degrading enzyme Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG15978-ACRRBS22240
Человек Insulysin/insulin-degrading enzyme Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG15978-CFRBS20190
Человек Insulysin/insulin-degrading enzyme Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG15978-CHRBS20190
Человек Insulysin/insulin-degrading enzyme Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG15978-CMRBS20190
Человек Insulysin/insulin-degrading enzyme Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG15978-CYRBS20190
Человек Insulysin/insulin-degrading enzyme Джин клон кДНК в вектор клонированияHG15978-GRBS5130
Человек Insulysin/insulin-degrading enzyme Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG15978-NFRBS20190
Человек Insulysin/insulin-degrading enzyme Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG15978-NHRBS20190
Человек Insulysin/insulin-degrading enzyme Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG15978-NMRBS20190
Человек Insulysin/insulin-degrading enzyme Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG15978-NYRBS20190
Человек Insulysin/insulin-degrading enzyme Джин ORF экспрессии кДНК клона плазмидыHG15978-UTRBS20190
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG15978-NH
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».