Быстрый заказ

Человек Insulysin/insulin-degrading enzyme Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human IDE Информация о продукте «Клон cDNA»
Размер кДНК:3060bp
Описание кДНК:Full length Clone DNA of Homo sapiens insulin-degrading enzyme with N terminal His tag.
Синоним гена:INSULYSIN
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Человек Insulysin/insulin-degrading enzyme Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Человек Insulysin/insulin-degrading enzyme Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG15978-ACGRBS22240
Человек Insulysin/insulin-degrading enzyme Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG15978-ACRRBS22240
Человек Insulysin/insulin-degrading enzyme Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG15978-CFRBS20190
Человек Insulysin/insulin-degrading enzyme Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG15978-CHRBS20190
Человек Insulysin/insulin-degrading enzyme Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG15978-CMRBS20190
Человек Insulysin/insulin-degrading enzyme Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG15978-CYRBS20190
Человек Insulysin/insulin-degrading enzyme Джин клон кДНК в вектор клонированияHG15978-GRBS5130
Человек Insulysin/insulin-degrading enzyme Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG15978-NFRBS20190
Человек Insulysin/insulin-degrading enzyme Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG15978-NHRBS20190
Человек Insulysin/insulin-degrading enzyme Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG15978-NMRBS20190
Человек Insulysin/insulin-degrading enzyme Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG15978-NYRBS20190
Человек Insulysin/insulin-degrading enzyme Джин ORF экспрессии кДНК клона плазмидыHG15978-UTRBS20190
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG15978-NH
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.