Быстрый заказ

Человек ICAM4 / CD242 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек ICAM4 Информация о продукте «Клон cDNA»
    Размер кДНК:819bp
    Описание кДНК:Full length Clone DNA of Homo sapiens ?intercellular adhesion molecule 4 (Landsteiner-Wiener blood group)? with C terminal Flag tag.
    Синоним гена:LW, CD242, ICAM4
    Участок рестрикции:
    Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
    Описание последовательности:
    ( We provide with ICAM4 qPCR primers for gene expression analysis, HP102032 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    FLAG Tag Info

    FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

    The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

    Человек ICAM4 / CD242 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
    Человек ICAM4 / CD242 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13327-ACGRBS15400
    Человек ICAM4 / CD242 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13327-ACRRBS15400
    Человек ICAM4 / CD242 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13327-CFRBS13340
    Человек ICAM4 / CD242 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13327-CHRBS13340
    Человек ICAM4 / CD242 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13327-CMRBS13340
    Человек ICAM4 / CD242 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13327-CYRBS13340
    Человек ICAM4 / CD242 Джин клон кДНК в вектор клонированияHG13327-GRBS5130
    Человек ICAM4 / CD242 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13327-NFRBS13340
    Человек ICAM4 / CD242 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13327-NHRBS13340
    Человек ICAM4 / CD242 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13327-NMRBS13340
    Человек ICAM4 / CD242 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13327-NYRBS13340
    Человек ICAM4 / CD242 Джин ORF экспрессии кДНК клона плазмидыHG13327-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name

    ICAM4, also known as CD242, is a member of the?immunoglobulin superfamily, ICAM family. ICAM4 contains 2?Ig-like C2-type (immunoglobulin-like) domains. It is similar to the intercellular adhesion molecule (ICAM) protein family. ICAM4 binds to the leukocyte adhesion LFA-1 protein. ICAM4's first reported receptors were CD11a/CD18 and CD11b/CD18. ICAM4 functions as a ligand for the monocyte/macrophage-specific CD11c/CD18. Deletion of the individual immunoglobulin domains of ICAM4 demonstrated that both its domains contain binding sites for CD11c/CD18. CD11c/CD18 is expressed on macrophages in spleen and bone marrow. Inhibition of erythrophagocytosis by anti-ICAM4 and anti-integrin antibodies suggests a role for these interactions in removal of senescent red cells.

  • Gorst DW. et al., 1980, Vox Sanguinis. 38 (2): 99-105.
  • Vos GH. et al., 1973, Blood. 42 (3): 445-53.
  • Kim W. et al., 2011, Mol Cell. 44 (2): 325-40.
  • Daniels G. et al., 2002, Transfusion Medicine. 12 (5): 287-95.
  • Size / Price
    Каталог: HG13327-CF
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.